Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Erratum to: Low expression of ULK1 is associated with operable breast cancer progression and is an adverse prognostic marker of survival for patients

Erratum to "Ultrasound Controllable Release of Proteolysis Targeting Chimeras for Triple-Negative Breast Cancer Treatment"

Erratum: Artemin is estrogen regulated and mediates antiestrogen resistance in mammary carcinoma

Erratum: the FoxO–BNIP3 Axis Exerts a Unique Regulation of Mtorc1 and Cell Survival under Energy Stress

Corrigendum: Identification of DYNLT1 associated with proliferation, relapse, and metastasis in breast cancer

[Corrigendum] High PLK4 Expression Promotes Tumor Progression and Induces Epithelial‑mesenchymal Transition by Regulating the Wnt/β‑catenin Signaling Pathway in Colorectal Cancer

Correction to: Novel smac mimetic APG-1387 elicits ovarian cancer cell killing through TNF-alpha, Ripoptosome and autophagy mediated cell death pathway (Journal of Experimental and Clinical Cancer Research (2018) 37 (53) DOI: 10.1186/s13046-018-0703-9)

Erratum to erratum to miR-3614-3p suppresses cell aggressiveness of human breast cancer by targeting AKT3 and HDAC1 expression

Erratum to "BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells"

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

Correction: Huang et al. Identification of the Novel Tumor Suppressor Role of FOCAD/miR-491-5p to Inhibit Cancer Stemness, Drug Resistance and Metastasis via Regulating RABIF/MMP Signaling in Triple Negative Breast Cancer. Cells 2021, 10, 2524

Erratum: CXCL12 Chemokine Expression Suppresses Human Breast Cancer Growth and Metastasis in Vitro and in Vivo.

Erratum: Dual inhibition of PFKFB3 and VEGF normalizes tumor vasculature, reduces lactate production, and improves chemotherapy in glioblastoma: insights from protein expression profiling and MRI: Erratum

[Corrigendum] MicroRNA‑92a Contributes to Tumor Growth of Human Hepatocellular Carcinoma by Targeting FBXW7

Erratum to "DAB2IP Downregulation Enhances the Proliferation and Metastasis of Human Gastric Cancer Cells by Derepressing the ERK1/2 Pathway".

Erratum: Transcriptional Downregulation of Mir-4306 Serves As a New Therapeutic Target for Triple Negative Breast Cancer: Erratum.

[Corrigendum] High PLK4 expression promotes tumor progression and induces epithelial‑mesenchymal transition by regulating the Wnt/β‑catenin signaling pathway in colorectal cancer.

[Corrigendum] Overexpression of HES6 Has Prognostic Value and Promotes Metastasis Via the Wnt/β-catenin Signaling Pathway in Colorectal Cancer.

Erratum: HOXC10 promotes carboplatin resistance of ovarian cancer by regulating ABCC3.

Erratum to upregulation of long noncoding RNA RAB11B-AS1 promotes tumor metastasis and predicts poor prognosis in lung cancer

Corrigendum: Identification of BRCA1:c.5470_5477del as a Founder Mutation in Chinese Ovarian Cancer Patients