Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Erratum: the FoxO–BNIP3 Axis Exerts a Unique Regulation of Mtorc1 and Cell Survival under Energy Stress

Correction to: Cryptotanshinone activates AMPK-TSC2 axis leading to inhibition of mTORC1 signaling in cancer cells

Correction: FOXO3a-dependent regulation of Puma in response to cytokine/growth factor withdrawal

Erratum: Artemin is estrogen regulated and mediates antiestrogen resistance in mammary carcinoma

Erratum: A Stress-Induced Cellular Aging Model with Postnatal Neural Stem Cells

Erratum: Epigenomic characterization of a p53-regulated 3p22.2 tumor suppressor that inhibits STAT3 phosphorylation via protein docking and is frequently methylated in esophageal and other carcinomas: Erratum.

Erratum: STAT3 selectively interacts with Smad3 to antagonize TGF-β signalling

Erratum: the PI 3-Kinase/akt Signaling Pathway is Activated Due to Aberrant Pten Expression and Targets Transcription Factors NF-κB and C-Myc in Pancreatic Cancer Cells

Author Correction: SZT2 dictates GATOR control of mTORC1 signalling

Erratum: Dual inhibition of PFKFB3 and VEGF normalizes tumor vasculature, reduces lactate production, and improves chemotherapy in glioblastoma: insights from protein expression profiling and MRI: Erratum

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

Targeting Epstein-Barr virus oncoprotein LMP1-mediated high oxidative stress suppresses EBV lytic reactivation and sensitizes tumors to radiation therapy: Erratum

Correction: Regulation of ATG4B Stability by RNF5 Limits Basal Levels of Autophagy and Influences Susceptibility to Bacterial Infection.

Correction to: Novel smac mimetic APG-1387 elicits ovarian cancer cell killing through TNF-alpha, Ripoptosome and autophagy mediated cell death pathway (Journal of Experimental and Clinical Cancer Research (2018) 37 (53) DOI: 10.1186/s13046-018-0703-9)

Erratum: Adipocytes fuel gastric cancer omental metastasis via PITPNC1-mediated fatty acid metabolic reprogramming: Erratum

[Retracted] MicroRNA‐320a suppresses tumour cell proliferation and invasion of renal cancer cells by targeting FoxM1

Erratum: mTOR regulates MAPKAPK2 translation to control the senescence-associated secretory phenotype

Erratum to: Control of cell growth: Rag GTPases in activation of TORC1

Correction: Celastrol Suppresses Angiogenesis-Mediated Tumor Growth through Inhibition of AKT/Mammalian Target of Rapamycin Pathway

[Corrigendum] PRIMA‐1 met induces autophagy in colorectal cancer cells through upregulation of the mTOR/AMPK‐ULK1‐Vps34 signaling cascade

Author Correction: MTOR regulates the pro-tumorigenic senescence-associated secretory phenotype by promoting IL1A translation