Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

[Corrigendum] Long Non‑coding RNA AC245100.4 Promotes Prostate Cancer Tumorigenesis Via the Microrna‑145‑5p/rbbp5 Axis.

[Corrigendum] P2Y2 receptor promotes the migration and invasion of breast cancer cells via EMT‑related genes Snail and E‑cadherin

[Corrigendum] MicroRNA‑92a Contributes to Tumor Growth of Human Hepatocellular Carcinoma by Targeting FBXW7

[Corrigendum] Azurocidin 1 inhibits the aberrant proliferation of triple‐negative breast cancer through the regulation of pyroptosis

[Corrigendum] microRNA‐181a‐5p functions as an oncogene in renal cell carcinoma

[Corrigendum] miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer

[Corrigendum] Tumor suppressor PLZF regulated by lncRNA ANRIL suppresses proliferation and epithelial mesenchymal transformation of gastric cancer cells

[Corrigendum] HepaCAM inhibits cell proliferation and invasion in prostate cancer by suppressing nuclear translocation of the androgen receptor via its cytoplasmic domain

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis

[Corrigendum] Propofol‐induced HOXA11‐AS promotes proliferation, migration and invasion, but inhibits apoptosis in hepatocellular carcinoma cells by targeting miR‐4458

[Corrigendum] Resveratrol reverses P‐glycoprotein‐mediated multidrug resistance of U2OS/ADR cells by suppressing the activation of the NF‐κB and p38 MAPK signaling pathways

[Corrigendum] PRIMA‐1 met induces autophagy in colorectal cancer cells through upregulation of the mTOR/AMPK‐ULK1‐Vps34 signaling cascade

Corrigendum to ‘Mir-873/Pd-l1 Axis Regulates the Stemness of Breast Cancer Cells’ EBioMedicine 41 (2019) 395–407

[Corrigendum] Upregulation of centromere protein M promotes tumorigenesis: A potential predictive target for cancer in humans

[Corrigendum] Role of 4‑aminobutyrate Aminotransferase (ABAT) and the Lncrna Co‑expression Network in the Development of Myelodysplastic Syndrome

[Corrigendum] miR‐182‐5p contributes to radioresistance in naso-pharyngeal carcinoma by regulating BNIP3 expression

[Corrigendum] MicroRNA‑222‑3p promotes tumor cell migration and invasion and inhibits apoptosis, and is correlated with an unfavorable prognosis of patients with renal cell carcinoma

Correction: Corrigendum: Selective inhibition of EZH2 by ZLD1039 blocks H3K27methylation and leads to potent anti-tumor activity in breast cancer

[Corrigendum] Tripartite motif‐containing 11 regulates the proliferation and apoptosis of breast cancer cells

[Corrigendum] High PLK4 Expression Promotes Tumor Progression and Induces Epithelial‑mesenchymal Transition by Regulating the Wnt/β‑catenin Signaling Pathway in Colorectal Cancer