Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Erratum to erratum to miR-3614-3p suppresses cell aggressiveness of human breast cancer by targeting AKT3 and HDAC1 expression

Erratum to ESM1 promotes triple-negative breast cancer cell proliferation through activating AKT/NF-κB/Cyclin D1 pathway

Erratum to MiR-140-5p targets Prox1 to regulate the proliferation and differentiation of neural stem cells through the ERK/MAPK signaling pathway

Erratum to MicroRNA-106a suppresses prostate cancer proliferation, migration and invasion by targeting tumor-derived IL-8

Corrigendum to ‘Mir-873/Pd-l1 Axis Regulates the Stemness of Breast Cancer Cells’ EBioMedicine 41 (2019) 395–407

Corrigendum to “Blockade of miR-3614 maturation by IGF2BP3 increases TRIM25 expression and promotes breast cancer cell proliferation” [EBioMedicine 41 (2019) 357–369]

Erratum to lncRNA HOXD-AS2 regulates miR-3681-5p/DCP1A axis to promote the progression of non-small cell lung cancer

[Corrigendum] Effects of miR‑340 overexpression and knockdown on the proliferation and metastasis of NSCLC cell lines

Correction to: Hsa-miR-623 suppresses tumor progression in human lung adenocarcinoma

Corrigendum: Downregulation of GLYAT Facilitates Tumor Growth and Metastasis and Poor Clinical Outcomes Through the PI3K/AKT/Snail Pathway in Human Breast Cancer

[Corrigendum] MicroRNA‑222‑3p promotes tumor cell migration and invasion and inhibits apoptosis, and is correlated with an unfavorable prognosis of patients with renal cell carcinoma

[Corrigendum] miR‐26a inhibits ovarian cancer cell proliferation, migration and invasion by targeting TCF12

[Retracted] MicroRNA‐320a suppresses tumour cell proliferation and invasion of renal cancer cells by targeting FoxM1

Correction: Huang et al. Identification of the Novel Tumor Suppressor Role of FOCAD/miR-491-5p to Inhibit Cancer Stemness, Drug Resistance and Metastasis via Regulating RABIF/MMP Signaling in Triple Negative Breast Cancer. Cells 2021, 10, 2524

[Corrigendum] microRNA‐181a‐5p functions as an oncogene in renal cell carcinoma

Erratum to PITPNC1 fuels radioresistance of rectal cancer by inhibiting reactive oxygen species production

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis

[Corrigendum] miR-30d inhibits cell biological progression of Ewing’s sarcoma by suppressing the MEK/ERK and PI3K/Akt pathways <i>in vitro</i>

[Corrigendum] Roles of the H19/microRNA‑675 Axis in the Proliferation and Epithelial‑mesenchymal Transition of Human Cutaneous Squamous Cell Carcinoma Cells

[Corrigendum] Propofol‐induced HOXA11‐AS promotes proliferation, migration and invasion, but inhibits apoptosis in hepatocellular carcinoma cells by targeting miR‐4458