Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Correction: Huang et al. Identification of the Novel Tumor Suppressor Role of FOCAD/miR-491-5p to Inhibit Cancer Stemness, Drug Resistance and Metastasis via Regulating RABIF/MMP Signaling in Triple Negative Breast Cancer. Cells 2021, 10, 2524

Correction: Huang et al. Endogenous Propionibacterium acnes Promotes Ovarian Cancer Progression via Regulating Hedgehog Signalling Pathway. Cancers 2022, 14, 5178

Correction To: MiRNA-195-5p Functions As a Tumor Suppressor and a Predictive of Poor Prognosis in Non-small Cell Lung Cancer by Directly Targeting CIAPIN1

Erratum to erratum to miR-3614-3p suppresses cell aggressiveness of human breast cancer by targeting AKT3 and HDAC1 expression

Corrigendum to ‘Mir-873/Pd-l1 Axis Regulates the Stemness of Breast Cancer Cells’ EBioMedicine 41 (2019) 395–407

[Corrigendum] MicroRNA‑92a Contributes to Tumor Growth of Human Hepatocellular Carcinoma by Targeting FBXW7

Correction: Shi, H., et al. Arctigenin Attenuates Breast Cancer Progression through Decreasing GM-CSF/TSLP/STAT3/β-Catenin Signaling. Int. J. Mol. Sci. 2020, 21, 6357

Correction: Antón-García et al. TGFβ1-Induced EMT in the MCF10A Mammary Epithelial Cell Line Model Is Executed Independently of SNAIL1 and ZEB1 but Relies on JUNB-Coordinated Transcriptional Regulation. Cancers 2023, 15, 588

Identification of the Novel Tumor Suppressor Role of FOCAD/miR-491-5p to Inhibit Cancer Stemness, Drug Resistance and Metastasis via Regulating RABIF/MMP Signaling in Triple Negative Breast Cancer

Correction: Mansoori et al. HMGA2 Supports Cancer Hallmarks in Triple-Negative Breast Cancer. Cancers 2021, 13, 5197

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

Transcriptional Downregulation of miR-4306 serves as a New Therapeutic Target for Triple Negative Breast Cancer: Erratum

Correction to: Hsa-miR-623 suppresses tumor progression in human lung adenocarcinoma

Corrigendum: MicroRNA-16-1-3p Represses Breast Tumor Growth and Metastasis by Inhibiting PGK1-Mediated Warburg Effect.

[Corrigendum] miR‐26a inhibits ovarian cancer cell proliferation, migration and invasion by targeting TCF12

[Corrigendum] Tripartite motif‐containing 11 regulates the proliferation and apoptosis of breast cancer cells

[Corrigendum] miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer

Corrigendum: Regulation of microrna-497-targeting AKT2 influences tumor growth and chemoresistance to cisplatin in lung cancer

Correction: H19/let-7/LIN28 reciprocal negative regulatory circuit promotes breast cancer stem cell maintenance

Corrigendum: Upregulation of CCT-3 Induces Breast Cancer Cell Proliferation Through miR-223 Competition and Wnt/b-Catenin Signaling Pathway Activation

Correction to: Novel smac mimetic APG-1387 elicits ovarian cancer cell killing through TNF-alpha, Ripoptosome and autophagy mediated cell death pathway (Journal of Experimental and Clinical Cancer Research (2018) 37 (53) DOI: 10.1186/s13046-018-0703-9)