Transcriptional Downregulation of miR-4306 serves as a New Therapeutic Target for Triple Negative Breast Cancer: Erratum

Zitong Zhao,Lin Li,Peina Du,Liying Ma,Weimin Zhang,Leilei Zheng,Bo Lan,Bailin Zhang,Fei Ma,Bo Xu,Qimin Zhan,Yongmei Song

DOI: https://doi.org/10.7150/thno.82636

IF: 11.6

2023-01-01

Theranostics

Abstract:[This corrects the article DOI: 10.7150/thno.30701.].

medicine, research & experimental

What problem does this paper attempt to address?

Erratum: Transcriptional Downregulation of Mir-4306 Serves As a New Therapeutic Target for Triple Negative Breast Cancer: Erratum.

Zitong Zhao,Lin Li,Peina Du,Liying Ma,Weimin Zhang,Leilei Zheng,Bo Lan,Bailin Zhang,Fei Ma,Bo Xu,Qimin Zhan,Yongmei Song

DOI: https://doi.org/10.7150/thno.82636

IF: 11.6

2023-01-01

Theranostics

Abstract:[This corrects the article DOI: 10.7150/thno.30701.].
Corrigendum: CAR T Cells Targeting the Tumor MUC1 Glycoprotein Reduce Triple-Negative Breast Cancer Growth

Ru Zhou,Mahboubeh Yazdanifar,Lopamudra Das Roy,Lynsey M. Whilding,Artemis Gavrill,John Maher,Pinku Mukherjee

DOI: https://doi.org/10.3389/fimmu.2020.628776

IF: 7.3

2020-12-07

Frontiers in Immunology

Abstract:[This corrects the article DOI: 10.3389/fimmu.2019.01149.].

immunology
Microtubule-Associated Protein Mdp3 Promotes Breast Cancer Growth and Metastasis: Erratum

Tala,Songbo Xie,Xiaodong Sun,Xiaoou Sun,Jie Ran,Linlin Zhang,Dengwen Li,Min Liu,Gang Bao,Jun Zhou

DOI: https://doi.org/10.7150/thno.45566

IF: 11.6

2020-01-01

Theranostics

Abstract:[This corrects the article DOI: 10.7150/thno.9727.].
Erratum to "Ultrasound Controllable Release of Proteolysis Targeting Chimeras for Triple-Negative Breast Cancer Treatment"

Hongye He,Feng Li,Rui Tang,Nianhong Wu,Ying Zhou,Yuting Cao,Can Wang,Li Wan,Yang Zhou,Hua Zhuang,Pan Li

DOI: https://doi.org/10.34133/bmr.0088

2024-10-07

Abstract:[This corrects the article DOI: 10.34133/bmr.0064.].
Correction To: MiRNA-195-5p Functions As a Tumor Suppressor and a Predictive of Poor Prognosis in Non-small Cell Lung Cancer by Directly Targeting CIAPIN1

Jing Zheng,Tao Xu,Feng Chen,Ying Zhang

DOI: https://doi.org/10.1007/s12253-020-00794-3

2020-01-01

Abstract:The original version of this article unfortunately contained an error in the affiliation section.
MicroRNA-647 Targets SRF-MYH9 Axis to Suppress Invasion and Metastasis of Gastric Cancer: Erratum

Gengtai Ye,Kai Huang,Jiang Yu,Liying Zhao,Xuejun Zhu,Qingbin Yang,Wende Li,Yuming Jiang,Baoxiong Zhuang,Hao Liu,Zhiyong Shen,Da Wang,Yan Li,Lei Zhang,Huixia Zhou,Yanfeng Hu,Haijun Deng,G Li,Xiaolong Qi

DOI: https://doi.org/10.7150/thno.31741

IF: 11.6

2018-01-01

Theranostics

Abstract:[This corrects the article DOI: 10.7150/thno.20512.].
miR-199a-3p/5p regulate tumorgenesis via targeting Rheb in non-small cell lung cancer: Erratum

Xiaomin Liu,Xianyi Wang,Binshu Chai,Zong Wu,Zhenyu Gu,Heng Zou,Hui Zhang,Yanli Li,Qiangling Sun,Wentao Fang,Zhongliang Ma

DOI: https://doi.org/10.7150/ijbs.86344

2023-01-01

International Journal of Biological Sciences

Abstract:[This corrects the article DOI: 10.7150/ijbs.70312.].
Involvement of miR-619-5p in resistance to cisplatin by regulating ATXN3 in oral squamous cell carcinoma: Erratum

An Song,Yuanyuan Wu,Weiming Chu,Xueming Yang,Zaiou Zhu,Enshi Yan,Wei Zhang,Junbo Zhou,Xu Ding,Jie Liu,Hongxia Zhu,Jinhai Ye,Yunong Wu,Yang Zheng,Xiaomeng Song

DOI: https://doi.org/10.7150/ijbs.94832

2024-01-01

International Journal of Biological Sciences

Abstract:[This corrects the article DOI: 10.7150/ijbs.54014.].

biochemistry & molecular biology
Correction: Upregulation of YPEL3 expression and induction of human breast cancer cell death by microRNAs

Boyoung Lee,Yeo-Jung Kwon,Sangyun Shin,Tae-Uk Kwon,Hyemin Park,Hyein Lee,Ji-Heung Kwak,Young-Jin Chun

DOI: https://doi.org/10.1007/s43188-024-00261-0

2024-08-29

Abstract:[This corrects the article DOI: 10.1007/s43188-024-00251-2.].
Erratum: circPTCH1 promotes invasion and metastasis in renal cell carcinoma via regulating miR-485-5p/MMP14 axis: Erratum.

Huan Liu,Guanghui Hu,Zaoyu Wang,Qunlong Liu,Jin Zhang,Yonghui Chen,Yiran Huang,Wei Xue,Yunfei Xu,Wei Zhai

DOI: https://doi.org/10.7150/thno.69378

IF: 11.6

2022-01-01

Theranostics

Abstract:[This corrects the article DOI: 10.7150/thno.47239.].
Corrigendum: Downregulation of GLYAT Facilitates Tumor Growth and Metastasis and Poor Clinical Outcomes Through the PI3K/AKT/Snail Pathway in Human Breast Cancer

Xin Tian,Lina Wu,Min Jiang,Zhenyong Zhang,Rong Wu,Jianing Miao,Caigang Liu,Song Gao

DOI: https://doi.org/10.3389/fonc.2022.793448

IF: 4.7

2022-04-06

Frontiers in Oncology

Abstract:[This corrects the article DOI: 10.3389/fonc.2021.641399.].

oncology
Erratum: MicroRNA-449a Inhibits Tumor Metastasis through AKT/ERK1/2 Inactivation by Targeting Steroid Receptor Coactivator (SRC) in Endometrial Cancer: Erratum.

Yuan Hu,An-Yue Wu,Cong Xu,Ke-Qi Song,Wen-Jing Wang,Xia Yin,Wen Di,Zu-Bei Hong,Li-Hua Qiu

DOI: https://doi.org/10.7150/jca.92673

IF: 3.9

2023-01-01

Journal of Cancer

Abstract:[This corrects the article DOI: 10.7150/jca.27748.].
[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis

Jin Xu,Nan Sang,Junning Zhao,Wei He,Nannan Zhang,Xueliang Li

DOI: https://doi.org/10.3892/mmr.2024.13307

Abstract:Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I. The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR‑670‑5p and miR‑545‑3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].
Erratum: Long noncoding RNA LINC01123 promotes the proliferation and invasion of hepatocellular carcinoma cells by modulating the miR-34a-5p/TUFT1 axis: Erratum.

Zunqiang Xiao,Yang Liu,Junjun Zhao,Lijie Li,Linjun Hu,Qiliang Lu,Zhi Zeng,Xin Liu,Dongsheng Huang,Wei Yang,Qiuran Xu

DOI: https://doi.org/10.7150/ijbs.61130

2021-01-01

International Journal of Biological Sciences

Abstract:[This corrects the article DOI: 10.7150/ijbs.45457.].
Integrative Gene Expression Profiling Reveals That Dysregulated Triple Micrornas Confer Paclitaxel Resistance in Non-Small Cell Lung Cancer Via Cotargeting MAPT [Corrigendum]

Yuan‐Ming Cai,Ruxue Jia,Haozhe Xiong,Qun Ren,Weimin Zuo,Tingting Lin,Rui‐Biao Lin,Yan Liu,Píng Wang,Huiyue Dong,Haitao Zhao,Lihua Zhu,Yunfeng Fu,Zhiyong Zeng,Wei Zhang,Shuiliang Wang

DOI: https://doi.org/10.2147/cmar.s293923

2020-01-01

Cancer Management and Research

Abstract:[This corrects the article DOI: 10.2147/CMAR.S215427.].
Corrigendum: Downregulation of miR-135b-5p Suppresses Progression of Esophageal Cancer and Contributes to the Effect of Cisplatin

Yuzhu Di,Yanan Jiang,Xiuyun Shen,Jing Liu,Yang Gao,Huimin Cai,Xiaoli Sun,Dandan Ning,Bing Liu,Jiaji Lei,Shizhu Jin

DOI: https://doi.org/10.3389/fonc.2021.785363

IF: 4.7

2021-11-15

Frontiers in Oncology

Abstract:[This corrects the article DOI: 10.3389/fonc.2021.679348.].

oncology
Correction: Huang et al. Identification of the Novel Tumor Suppressor Role of FOCAD/miR-491-5p to Inhibit Cancer Stemness, Drug Resistance and Metastasis via Regulating RABIF/MMP Signaling in Triple Negative Breast Cancer. Cells 2021, 10, 2524

Wei-Chieh Huang,Hsiang-Cheng Chi,Shiao-Lin Tung,Po-Ming Chen,Ya-Chi Shih,Yi-Ching Huang,Pei-Yi Chu

DOI: https://doi.org/10.3390/cells13221830

IF: 6

2024-11-07

Cells

Abstract:Cells, Vol. 13, Pages 1830: Correction: Huang et al. Identification of the Novel Tumor Suppressor Role of FOCAD/miR-491-5p to Inhibit Cancer Stemness, Drug Resistance and Metastasis via Regulating RABIF/MMP Signaling in Triple Negative Breast Cancer. Cells 2021, 10, 2524 Cells doi: 10.3390/cells13221830 Authors: Wei-Chieh Huang Hsiang-Cheng Chi Shiao-Lin Tung Po-Ming Chen Ya-Chi Shih Yi-Ching Huang Pei-Yi Chu In the original publication [...]

cell biology
Erratum to erratum to miR-3614-3p suppresses cell aggressiveness of human breast cancer by targeting AKT3 and HDAC1 expression

Editorial Office

DOI: https://doi.org/10.21037/tcr-2024-2

2024-09-02

Translational Cancer Research

Abstract:Editorial Office Translational Cancer Research Submitted Nov 20, 2023. Accepted for publication Jun 12, 2024. Published online Aug 27, 2024. doi: 10.21037/tcr-2024-2 Erratum to: Transl Cancer Res 2023;12:1372-5. In the May 2023 issue of Translational Cancer Research , the paper titled "Erratum to miR-3614-3p suppresses cell aggressiveness of human breast cancer by targeting AKT3 and HDAC1 expression" (Transl Cancer Res 2023;12(5):1372-1375. doi: 10.21037/tcr-23-674) (1), was published for correction of Figure 1C and Figure 5C in the article (2) published earlier. However, there are still some errors found in the aforementioned Figures 1C , 5C as well as in Figure 4C , while the figure legends remain intact. The Figure 1C should be corrected as: The Figure 4C should be corrected as: The Figure 5C should be corrected as: The authors confirmed that these corrections do not change the description or original conclusions of the paper and sincerely apologize for any inconvenience caused by these mistakes. Click here to view the updated version of the article. Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

oncology
A Long Non-coding RNA Lnc712 Regulates Breast Cancer Cell Proliferation: Erratum

Yue Cui,Chunxiao Lu,Zhiming Zhang,Aiqin Mao,Lei Feng,Li Fu,Feng Gu,Xin Ma,Dongxu He

DOI: https://doi.org/10.7150/ijbs.81665

2023-01-01

International Journal of Biological Sciences

Abstract:[This corrects the article DOI: 10.7150/ijbs.36429.].
Erratum to "BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells"

Bin Ma,Wenjia Guo,Meihui Shan,Nan Zhang,Binlin Ma,Gang Sun

DOI: https://doi.org/10.1515/biol-2022-0810

2023-12-16

Abstract:[This corrects the article DOI: 10.1515/biol-2020-0054.].

Transcriptional Downregulation of miR-4306 serves as a New Therapeutic Target for Triple Negative Breast Cancer: Erratum

Erratum: Transcriptional Downregulation of Mir-4306 Serves As a New Therapeutic Target for Triple Negative Breast Cancer: Erratum.

Corrigendum: CAR T Cells Targeting the Tumor MUC1 Glycoprotein Reduce Triple-Negative Breast Cancer Growth

Microtubule-Associated Protein Mdp3 Promotes Breast Cancer Growth and Metastasis: Erratum

Erratum to "Ultrasound Controllable Release of Proteolysis Targeting Chimeras for Triple-Negative Breast Cancer Treatment"

Correction To: MiRNA-195-5p Functions As a Tumor Suppressor and a Predictive of Poor Prognosis in Non-small Cell Lung Cancer by Directly Targeting CIAPIN1

MicroRNA-647 Targets SRF-MYH9 Axis to Suppress Invasion and Metastasis of Gastric Cancer: Erratum

miR-199a-3p/5p regulate tumorgenesis via targeting Rheb in non-small cell lung cancer: Erratum

Involvement of miR-619-5p in resistance to cisplatin by regulating ATXN3 in oral squamous cell carcinoma: Erratum

Correction: Upregulation of YPEL3 expression and induction of human breast cancer cell death by microRNAs

Erratum: circPTCH1 promotes invasion and metastasis in renal cell carcinoma via regulating miR-485-5p/MMP14 axis: Erratum.

Corrigendum: Downregulation of GLYAT Facilitates Tumor Growth and Metastasis and Poor Clinical Outcomes Through the PI3K/AKT/Snail Pathway in Human Breast Cancer

Erratum: MicroRNA-449a Inhibits Tumor Metastasis through AKT/ERK1/2 Inactivation by Targeting Steroid Receptor Coactivator (SRC) in Endometrial Cancer: Erratum.

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis

Erratum: Long noncoding RNA LINC01123 promotes the proliferation and invasion of hepatocellular carcinoma cells by modulating the miR-34a-5p/TUFT1 axis: Erratum.

Integrative Gene Expression Profiling Reveals That Dysregulated Triple Micrornas Confer Paclitaxel Resistance in Non-Small Cell Lung Cancer Via Cotargeting MAPT [Corrigendum]

Corrigendum: Downregulation of miR-135b-5p Suppresses Progression of Esophageal Cancer and Contributes to the Effect of Cisplatin

Correction: Huang et al. Identification of the Novel Tumor Suppressor Role of FOCAD/miR-491-5p to Inhibit Cancer Stemness, Drug Resistance and Metastasis via Regulating RABIF/MMP Signaling in Triple Negative Breast Cancer. Cells 2021, 10, 2524

Erratum to erratum to miR-3614-3p suppresses cell aggressiveness of human breast cancer by targeting AKT3 and HDAC1 expression

A Long Non-coding RNA Lnc712 Regulates Breast Cancer Cell Proliferation: Erratum

Erratum to "BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells"