Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Erratum: Tumor Suppressor BRCA1 Epigenetically Controls Oncogenic Microrna-155

Tumor Suppressor BRCA1 Epigenetically Controls Oncogenic Microrna-155

Correction: PRMT5 Circular RNA Promotes Metastasis of Urothelial Carcinoma of the Bladder Through Sponging Mir-30C to Induce Epithelial–Mesenchymal Transition

Erratum: the FoxO–BNIP3 Axis Exerts a Unique Regulation of Mtorc1 and Cell Survival under Energy Stress

RETRACTION: MicroRNA-155 enhances the activation of Wnt/beta-catenin signaling in colorectal carcinoma by suppressing HMG-box transcription factor 1 (Retraction of Vol 13, Pg 2221, 2016)

Erratum: Artemin is estrogen regulated and mediates antiestrogen resistance in mammary carcinoma

Correction To: MiRNA-195-5p Functions As a Tumor Suppressor and a Predictive of Poor Prognosis in Non-small Cell Lung Cancer by Directly Targeting CIAPIN1

Erratum to erratum to miR-3614-3p suppresses cell aggressiveness of human breast cancer by targeting AKT3 and HDAC1 expression

Erratum: Epigenomic characterization of a p53-regulated 3p22.2 tumor suppressor that inhibits STAT3 phosphorylation via protein docking and is frequently methylated in esophageal and other carcinomas: Erratum.

Erratum to "BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells"

[Corrigendum] microRNA‐181a‐5p functions as an oncogene in renal cell carcinoma

Inhibition of SMYD2 suppresses tumor progression by down-regulating microRNA-125b and attenuates multi-drug resistance in renal cell carcinoma: Erratum

Corrigendum: Regulation of microrna-497-targeting AKT2 influences tumor growth and chemoresistance to cisplatin in lung cancer

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

Epigenomic characterization of a p53-regulated 3p22.2 tumor suppressor that inhibits STAT3 phosphorylation via protein docking and is frequently methylated in esophageal and other carcinomas: Erratum

Erratum: [Corrigendum] miR‑216a‑5p acts as an oncogene in renal cell carcinoma.

Corrigendum: Identification of BRCA1:c.5470_5477del as a Founder Mutation in Chinese Ovarian Cancer Patients

The Potential Tumor Promotional Role of circVAPA in Retinoblastoma via Regulating miR-615-3p and SMARCE1

Correction: Lepore Signorile et al. c-MYC Protein Stability Is Sustained by MAPKs in Colorectal Cancer. Cancers 2022, 14, 4840

Erratum: CD95 promotes tumour growth

Publisher Correction: Chromatin Dysregulation and DNA Methylation at Transcription Start Sites Associated with Transcriptional Repression in Cancers