Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Estrogen receptor α/prolactin receptor bilateral crosstalk promotes bromocriptine resistance in prolactinomas: Erratum

Erratum: Artemin is estrogen regulated and mediates antiestrogen resistance in mammary carcinoma

[Corrigendum] Zoledronic acid sensitizes breast cancer cells to fulvestrant via ERK/HIF‐1 pathway inhibition in vivo

Suppression of breast cancer-associated bone loss with osteoblast proteomes via Hsp90ab1/moesin-mediated inhibition of TGFβ/FN1/CD44 signaling: Erratum

Overcoming erlotinib resistance in EGFR mutation-positive lung adenocarcinomas through repression of phosphoglycerate dehydrogenase: Erratum

Erratum: MicroRNA-449a Inhibits Tumor Metastasis through AKT/ERK1/2 Inactivation by Targeting Steroid Receptor Coactivator (SRC) in Endometrial Cancer: Erratum.

Corrigendum: Downregulation of GLYAT Facilitates Tumor Growth and Metastasis and Poor Clinical Outcomes Through the PI3K/AKT/Snail Pathway in Human Breast Cancer

Correction: Infiltrating Mast Cells Increase Prostate Cancer Chemotherapy and Radiotherapy Resistances Via Modulation of P38/p53/p21 and ATM Signals.

Erratum to "BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells"

Transcriptional Downregulation of miR-4306 serves as a New Therapeutic Target for Triple Negative Breast Cancer: Erratum

Erratum: Dual inhibition of PFKFB3 and VEGF normalizes tumor vasculature, reduces lactate production, and improves chemotherapy in glioblastoma: insights from protein expression profiling and MRI: Erratum

Resveratrol counteracts bone loss via mitofilin-mediated osteogenic improvement of mesenchymal stem cells in senescence-accelerated mice: Erratum

Erratum to "Ultrasound Controllable Release of Proteolysis Targeting Chimeras for Triple-Negative Breast Cancer Treatment"

Correction: An Experimental Analysis of the Molecular Effects of Trastuzumab (Herceptin) and Fulvestrant (Falsodex), as Single Agents or in Combination, on Human HR+/HER2+ Breast Cancer Cell Lines and Mouse Tumor Xenografts

Corrigendum: Peroxisome proliferator–activated receptor-α: A pivotal regulator of the gastrointestinal tract

Erratum: "Hydroxylated Polybrominated Biphenyl Ethers Exert Estrogenic Effects via Nongenomic G Protein-Coupled Estrogen Receptor Mediated Pathways".

Autophagy Maintains the Function of Bone Marrow Mesenchymal Stem Cells to Prevent Estrogen Deficiency-Induced Osteoporosis: Erratum

Acidic Microenvironment Up-Regulates Exosomal miR-21 and miR-10b in Early-Stage Hepatocellular Carcinoma to Promote Cancer Cell Proliferation and Metastasis: Erratum

Real-world data combined with studies on Regulatory B Cells for newly diagnosed Multiple Myeloma from a tertiary referral Hospital in South-Western China: Erratum

Corrigendum: Chemoresistance and Metastasis in Breast Cancer Molecular Mechanisms and Novel Clinical Strategies

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway