Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Correction: Stat3 regulates ErbB-2 expression and co-opts ErbB-2 nuclear function to induce miR-21 expression, PDCD4 downregulation and breast cancer metastasis

Correction: Regua et al. TrkA Interacts with and Phosphorylates STAT3 to Enhance Gene Transcription and Promote Breast Cancer Stem Cells in Triple-Negative and HER2-Enriched Breast Cancers. Cancers 2021, 13, 2340

Correction: PRMT5 Circular RNA Promotes Metastasis of Urothelial Carcinoma of the Bladder Through Sponging Mir-30C to Induce Epithelial–Mesenchymal Transition

Correction To: KIF5B-RET Fusion Kinase Promotes Cell Growth by Multilevel Activation of STAT3 in Lung Cancer

Erratum to erratum to miR-3614-3p suppresses cell aggressiveness of human breast cancer by targeting AKT3 and HDAC1 expression

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

Correction To: MiRNA-195-5p Functions As a Tumor Suppressor and a Predictive of Poor Prognosis in Non-small Cell Lung Cancer by Directly Targeting CIAPIN1

Correction To: Methylseleninic Acid Suppresses Breast Cancer Growth Via the JAK2/STAT3 Pathway

Correction to: PPDPF promotes lung adenocarcinoma progression via inhibiting apoptosis and NK cell-mediated cytotoxicity through STAT3

Erratum: Artemin is estrogen regulated and mediates antiestrogen resistance in mammary carcinoma

Correction: Loss of EGFR Signaling-Regulated Mir-203 Promotes Prostate Cancer Bone Metastasis and Tyrosine Kinase Inhibitors Resistance

[Corrigendum] Azurocidin 1 inhibits the aberrant proliferation of triple‐negative breast cancer through the regulation of pyroptosis

Epigenomic characterization of a p53-regulated 3p22.2 tumor suppressor that inhibits STAT3 phosphorylation via protein docking and is frequently methylated in esophageal and other carcinomas: Erratum

Erratum: Epigenomic characterization of a p53-regulated 3p22.2 tumor suppressor that inhibits STAT3 phosphorylation via protein docking and is frequently methylated in esophageal and other carcinomas: Erratum.

Correction to: The IL-6-STAT3 axis mediates a reciprocal crosstalk between cancer-derived mesenchymal stem cells and neutrophils to synergistically prompt gastric cancer progression

Erratum: STAT3 selectively interacts with Smad3 to antagonize TGF-β signalling

[Corrigendum] MicroRNA‑222‑3p promotes tumor cell migration and invasion and inhibits apoptosis, and is correlated with an unfavorable prognosis of patients with renal cell carcinoma

Correction: Upregulation of YPEL3 expression and induction of human breast cancer cell death by microRNAs

Correction: TMEM158 promotes the proliferation and migration of glioma cells via STAT3 signaling in glioblastomas

[Corrigendum] miR‐27a‐3p regulates the inhibitory influence of endothelin 3 on the tumorigenesis of papillary thyroid cancer cells

[Corrigendum] Upregulation of centromere protein M promotes tumorigenesis: A potential predictive target for cancer in humans