Abstract:HomePlant DiseaseVol. 103, No. 12Loquat Is a New Natural Host of Apple Stem Grooving Virus and Apple Chlorotic Leaf Spot Virus in China PreviousNext DISEASE NOTES OPENOpen Access licenseLoquat Is a New Natural Host of Apple Stem Grooving Virus and Apple Chlorotic Leaf Spot Virus in ChinaQiyan Liu, Zhiyou Xuan, Jiaxing Wu, Yuanjian Qiu, Min Li, Song Zhang, Di Wu, Ruhui Li, and Mengji CaoQiyan LiuNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, ChinaSearch for more papers by this author, Zhiyou XuanNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, ChinaSearch for more papers by this author, Jiaxing WuNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, ChinaSearch for more papers by this author, Yuanjian QiuNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, ChinaSearch for more papers by this author, Min LiNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, ChinaSearch for more papers by this author, Song ZhangNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, ChinaSearch for more papers by this author, Di WuCollege of Horticulture and Landscape Architecture, Southwest University, Chongqing, 400715, ChinaSearch for more papers by this author, Ruhui Lihttp://orcid.org/0000-0002-9271-4208USDA-ARS, National Germplasm Resources Laboratory, Beltsville, MD 20705, U.S.A.Search for more papers by this author, and Mengji Cao†Corresponding author: M. Cao; E-mail Address: caomengji@cric.cnhttp://orcid.org/0000-0003-0396-262XNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, ChinaSearch for more papers by this author AffiliationsAuthors and Affiliations Qiyan Liu1 2 Zhiyou Xuan1 2 Jiaxing Wu1 2 Yuanjian Qiu1 2 Min Li1 2 Song Zhang1 2 Di Wu3 Ruhui Li4 Mengji Cao1 2 † 1National Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, China 2Academy of Agricultural Sciences, Southwest University, Chongqing 400715, China 3College of Horticulture and Landscape Architecture, Southwest University, Chongqing, 400715, China 4USDA-ARS, National Germplasm Resources Laboratory, Beltsville, MD 20705, U.S.A. Published Online:26 Sep 2019https://doi.org/10.1094/PDIS-04-19-0721-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Loquat (Eriobotrya japonica) is an evergreen tree species in the family Rosaceae. It is native to the cooler mountain regions of China to south-central China and cultivated in Asia and Europe for its fruit and as an ornamental (Janick et al. 2015; Lin et al. 2010). Leaves and fruits of loquats have traditionally been considered to have high medicinal value (Lin et al. 2007). In March 2018, a leaf curl symptom was observed on loquat trees in an orchard in Chongqing. A literature search did not reveal any reports describing viral pathogens infecting loquats, although several bacterial and fungal diseases have been documented (Man in ’t Veld et al. 2001; Wimalajeewa et al. 1978). To investigate the etiology of the symptoms, total RNA was extracted using EASYspin Plus Complex Plant RNA Kit (Aidlab Biotech) from the leaves of one symptomatic loquat tree. An rRNA-depleted library was subsequently built and sequenced by Illumina HiSeq X-ten platform. A total of 4,627,397 paired-end reads of 150 bp were obtained after removing the reads mapped to apple genome (Velasco et al. 2010). De novo assembly of the reads generated 112,563 contigs (>200 nt). BLAST analyses revealed that two contigs of 6,432 and 6,402 nt, and one contig of 7,501 nt, had high identities with Apple stem grooving virus and Apple chlorotic leaf spot virus, the members of the genus Capillovirus and Trichovirus, respectively. Virus infection in the loquat sample was reconfirmed by direct tissue blot immunoassay assay using the polyclonal antibody of ASGV and ACLSV (kindly gifted by Ni Hong of Huazhong Agriculture University). To obtain the complete viral genome sequences, reverse transcription PCR (RT-PCR) was performed using overlapping primer pairs designed from contig sequences of each virus. The 5′ and 3′ terminal sequences of each virus were amplified by rapid amplification of cDNA ends (RACE kit, Invitrogen). The amplicons were purified, cloned into the pGEM-T Easy Vector, and sequenced as described by Cao et al. (2018). The complete sequences of the viral isolates were determined to be 6,496 nt (ASGV-L2, MK599421), 6,496 nt (ASGV-L3, MK599422), and 7,542 nt (ACLSV-L1, MK599420). Global sequence alignment of ASGV-L2 and ASGV-L3 using the Needleman–Wunsch algorithm showed 87.9% nt identity. Sequence and phylogenetic analyses revealed that ASGV-L2 and ASGV-L3 were separated into two evolutionary paths most closely with ASGV isolates MTH (KC588948; 90.7% nt identity) and HH (JN701424; 91.4% nt identity) from citrus. Likewise, analyses suggested ACLSV-L1 is closest (83.7% nt identity) to ACLSV-SY02 isolate of hawthorn (KU870524). To further validate the ACLSV and ASGV infections in the loquats, isolate-specific primer pairs ASGV-L2F-1996 (CTTGGTCACAAAGGGTCTCTCA)/ASGV-L2R-2382 (AATCCAAGTCTTAGCCCAACAA), ASGV-L3F-2150 (AAGAAGGTGGTGAAGCACAGAT)/ASGV-L3R-2565 (TTCCATAAAGGTCCCATCAATC), and ACLSV-L1F-3748 (AATGACTTCACGGGCATAGATC)/ACLSV-L1R-4621 (GGTATTTTCCTTTACTTTCCGC), with 386-, 415-, and 873-bp expected amplicons, respectively, were used in RT-PCR to test 54 samples (30 were symptomatic and 24 asymptomatic). The results, in which 24 symptomatic samples were positive for ASGV (L2 and L3, 80%) and seven were positive for ACLSV (23%), whereas ASGV-infected asymptomatic samples were only three, showed association of ASGV with the symptoms. To our knowledge, this is the first report of natural infection of viral pathogens in loquats, showing the expanding host range of the viruses and our knowledge of virus diversity.The author(s) declare no conflict of interest.References:Cao, M., et al. 2018. Arch. Virol. 163:3479. https://doi.org/10.1007/s00705-018-4039-8 Crossref, ISI, Google ScholarJanick, J., et al. 2015. Acta Hortic. 1092:25. https://doi.org/10.17660/ActaHortic.2015.1092.2 Crossref, Google ScholarLin, S., et al. 2007. Chron. Hortic. 47:12. Google ScholarLin, S., et al. 2010. Hortic. Rev. (Am. Soc. Hortic. Sci.) 23. doi: 10.1002/9780470650752.ch5doi.org/10.1002/9780470650752.ch5 Google ScholarMan in ’t Veld, W. A. et al. 2001. Plant Dis. 85:98. https://doi.org/10.1094/PDIS.2001.85.1.98B Link, Google ScholarVelasco, R., et al. 2010. Nat. Genet. 42:833. https://doi.org/10.1038/ng.654 Crossref, ISI, Google ScholarWimalajeewa, D. L. S., et al. 1978. Australas. Plant Pathol. 7:33. https://doi.org/10.1071/APP9780033 Crossref, Google ScholarThe authors thank Ni Hong of Huazhong Agriculture University, who kindly gifted the polyclonal antibody of ASGV and ACLSV to them.The author(s) declare no conflict of interest.Funding: This research was supported by the Intergovernmental International Science, Technology and Innovation (STI) Collaboration Key Project of China’s National Key R&D Programme (NKP) (2017YFE0110900), Fundamental Research Funds for the Central Universities (XDJK2018AA002), Chongqing Research Program of Basic Research and Frontier Technology (cstc2017jcyjBX0016), and Overseas Expertise Introduction Project for Discipline Innovation (111 Center) (B18044).DetailsFiguresLiterature CitedRelated Vol. 103, No. 12 December 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionChlorotic symptom of Paris polyphylla var. yunnanensis infected by PMMoV-QJ (Wen et al.). Photo credit: M. F. Zhao. Symptoms of Puccinia triticina on wheat (Brar et al.). Photo credit: G. S. Brar. Metrics Downloaded 3,053 times Article History Issue Date: 21 Nov 2019Published: 26 Sep 2019First Look: 19 Jul 2019Accepted: 15 Jul 2019 Pages: 3290-3290 Information© 2019 The American Phytopathological SocietyFundingIntergovernmental International Science, Technology and Innovation (STI) Collaboration Key Project of China’s National Key R&D Programme (NKP)Grant/Award Number: 2017YFE0110900Fundamental Research Funds for the Central UniversitiesGrant/Award Number: XDJK2018AA002Chongqing Research Program of Basic Research and Frontier TechnologyGrant/Award Number: cstc2017jcyjBX0016Overseas Expertise Introduction Project for Discipline Innovation (111 Center)Grant/Award Number: B18044KeywordsloquatvirusASGVACLSVNGSThe author(s) declare no conflict of interest.Cited ByBiological and molecular characterization of two isolates of apple stem grooving virus revealed distinct properties and indicates virus emergence driven by recombination30 September 2021 | Journal of Phytopathology, Vol. 149First report of Cnidium officinale as a natural host plant of Apple stem grooving virus in South Korea28 July 2021 | Plant Disease, Vol. 44Loquat (Eriobotrya japonica) Is a New Natural Host of Apple Stem Pitting Virus13 November 2020 | Plants, Vol. 9, No. 11Frontiers in Microbiology, Vol. 11Complete nucleotide sequence of loquat virus A, a member of the family Betaflexiviridae with a novel genome organization26 October 2019 | Archives of Virology, Vol. 165, No. 1

Abstract:HomePlant DiseaseVol. 103, No. 10First Report of Citrus Vein Enation Virus from Citrus Cultivar Huangguogan in Sichuan Province, China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Citrus Vein Enation Virus from Citrus Cultivar Huangguogan in Sichuan Province, ChinaJiaxing Wu, Qiyan Liu, Yuanjian Qiu, Song Zhang, Zhongan Li, Ruhui Li, Changyong Zhou, and Mengji CaoJiaxing WuNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this author, Qiyan LiuNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this author, Yuanjian QiuNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this author, Song ZhangNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this author, Zhongan LiNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this author, Ruhui Lihttp://orcid.org/0000-0002-9271-4208USDA-ARS, National Germplasm Resources Laboratory, Beltsville, MD 20705, U.S.A.Search for more papers by this author, Changyong ZhouNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this author, and Mengji Cao†Corresponding author: M. Cao; E-mail Address: caomengji@cric.cnhttp://orcid.org/0000-0003-0396-262XNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this authorAffiliationsAuthors and Affiliations Jiaxing Wu1 Qiyan Liu1 Yuanjian Qiu1 Song Zhang1 Zhongan Li1 Ruhui Li2 Changyong Zhou1 Mengji Cao1 † 1National Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, China 2USDA-ARS, National Germplasm Resources Laboratory, Beltsville, MD 20705, U.S.A. Published Online:7 Aug 2019https://doi.org/10.1094/PDIS-03-19-0461-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Citrus fruit production in Sichuan, the third citrus producing province in China, increased dramatically, from 4 million acres in 2014 to 6 million acres in 2017. However, the yield and quality of citrus fruits are greatly affected by various diseases, including viral diseases. Citrus vein enation virus (CVEV), a member of the genus Enamovirus in the family Luteoviridae, is the causal agent of citrus vein enation disease (Vives et al. 2013). In 2016, symptoms of tree decline, fruit dysplasia, and superficial necrotic spots were observed on Huangguogan (Citrus sinensis × C. reticulata) trees in Shimian county, Sichuan province, China. To identify viral and virus-like pathogens in the symptomatic trees, total RNA was extracted from the leaf tissues of one symptomatic tree and subjected to ribosomal RNA depletion. A cDNA library was constructed using a TruSeq RNA Sample Prep kit (Illumina, San Diego, CA), and sequencing was conducted with an Illumina HiSeq X-ten platform (Mega Genomics, Beijing, China). A total of 15,216,605 clean nonhost reads were assembled de novo by CLC Genomics Workbench 9.5 (Qiagen). BLAST searches of the resulting contigs revealed the presence of only one virus contig of 5,958 nt nearly identical (99.13%) to CVEV isolates from Zhejiang province, China (Huang et al. 2015). To obtain the whole genome sequence of the CVEV isolate, sequences of six known CVEV isolates (CVEV-PCJ: LC_433634; CVEV-STM-1: LC_089853; CVEV-YM1: LC_089850; CVEV-VE-1: HF_679486; CVEV-IBK: LC_089852, and CVEV-PTC: LC_433635) and the CVEV contig obtained in this study were aligned, and primers pairs were designed to generate overlapping amplicons. Reverse transcription PCR (RT-PCR) and 5′/3′ rapid amplification of cDNA ends (RACE) assays were conducted using OneStep RT-PCR (Takara Bio) and RACE (ThermoFisher Scientific Corp.) kits, respectively. The complete genomic sequence of the Huangguogan-SM isolate of CVEV, designated as CVEV-SM (accession no. KY303624), was determined to be 5,983 nt, which shared the highest nucleotide sequence identity of 97.4% with that of a Korean isolate CVEV-PCJ. Buds collected from the diseased trees were graft inoculated onto Mexican lime (C. aurantifolia) seedlings, and the grafted plants were maintained in a screenhouse. Six months after inoculation, small papillae were observed on leaf veins of the lower surface on the five Mexican lime trees, and the CVEV infection was confirmed by RT-PCR using virus-specific primers (JC-F1: GGAATGCCTTGCTACCAT; JC-R1: GAGAGGTGAATAACGCACAG). To investigate the incidence of CVEV in the orchards, samples were collected from 65 Huangguogan trees with or without symptoms from four orchards in Shimian county and tested by RT-PCR. Results showed that 52 of 55 symptomatic samples and six of the 10 asymptomatic samples were virus infected, suggesting that CVEV is widespread in the region. To our knowledge, this is the first report of CVEV in Sichuan province, China, which expands our knowledge on its distribution and genetic variation. Moreover, CVEV can be transmitted by propagation and by several species of aphids, and thus the virus can be a serious threat to the cultivation of citrus in Sichuan province.The author(s) declare no conflict of interest.References:Huang, A. J., et al. 2015. J. Integr. Agric. 14:598. https://doi.org/10.1016/S2095-3119(14)60903-5 Crossref, ISI, Google ScholarVives, M. C., et al. 2013. Phytopathology 103:1077. https://doi.org/10.1094/PHYTO-03-13-0068-R Link, ISI, Google ScholarThe author(s) declare no conflict of interest.Funding: This research was supported by the Intergovernmental International Science, Technology and Innovation (STI) Collaboration Key Project of China’s National Key R&D Programme (NKP) (2017YFE0110900), Fundamental Research Funds for the Central Universities (XDJK2018AA002), Chongqing Research Program of Basic Research and Frontier Technology (cstc2017jcyjBX0016), and Overseas Expertise Introduction Project for Discipline Innovation (111 Center) (B18044).DetailsFiguresLiterature CitedRelated Vol. 103, No. 10 October 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionBell pepper cv. Bomby infected with zucchini yellow mosaic virus along with cucumber mosaic virus, pepper mild mottle virus, and tobacco mosaic virus (Verma et al.). Photo credit: S. Tripathi. Severe stunting, leaf chlorosis, and horizontal head growth of sunflower infected with Plasmopara halstedii, causal agent of downy mildew (Humann et al.). Photo credit: S. Markell. Metrics Article History Issue Date: 3 Oct 2019Published: 7 Aug 2019First Look: 14 Jun 2019Accepted: 12 Jun 2019 Pages: 2701-2701 Information© 2019 The American Phytopathological SocietyFundingIntergovernmental International Science, Technology and Innovation (STI) Collaboration Key Project of China’s National Key R&D Programme (NKP)Grant/Award Number: 2017YFE0110900Fundamental Research Funds for the Central UniversitiesGrant/Award Number: XDJK2018AA002Chongqing Research Program of Basic Research and Frontier TechnologyGrant/Award Number: cstc2017jcyjBX0016Overseas Expertise Introduction Project for Discipline Innovation (111 Center)Grant/Award Number: B18044Keywordsviruses and viroidstree fruitspathogen detectionThe author(s) declare no conflict of interest.Cited byMolecular Variation and Genomic Function of Citrus Vein Enation Virus27 December 2022 | International Journal of Molecular Sciences, Vol. 24, No. 1

Viral Small RNA-Based Screening of Malus Spp. Reveals Citrus Leaf Blotch Virus Infection of Kaido Crab Apple in China

First Report of Citrus Leaf Blotch Virus in Sweet Cherry.

First Report of Citrus Leaf Blotch Virus in Lemon in China

First Report of Prunus Necrotic Ringspot Virus Infection of Apple in China

Molecular Characterization of a Novel Chlorotic Leaf Curl-Associated Foveavirus Infecting Prune Trees

Loquat is a New Natural Host of Apple Stem Grooving Virus and Apple Chlorotic Leaf Spot Virus in China

First Report of Citrus Vein Enation Virus from Citrus Cultivar Huangguogan in Sichuan Province, China

First Report of Apple Stem Grooving Virus Infecting Rosa Chinensis in China

First Report of Citrus Chlorotic Dwarf-Associated Virus on Pomelo in Nakhon, Thailand

First Report of Pepper Veinal Mottle Virus Infecting Pepper in Mainland China

First Report of Lettuce Chlorosis Virus Infecting Tomato in China

First Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium Candidum in China

First Report of Peach Calico Isolate of Peach Latent Mosaic Viroid from Peach Trees in China

First Report of a Secovirus Associated with Mountain Celery Chlorotic Spot Disease in Heilongjiang, China.

First Report of Ligustrum Virus A on Syringa Reticulata Var. Mandshurica (oleaceae) with a New Yellow Vein and Malformed Needle-Shaped Leaf Disease in China.

First Molecular Evidence of Citrus Yellow Vein Clearing Virus from Citrus in Punjab, Pakistan.

Pome fruit viruses at the Canadian Clonal Genebank and molecular characterization of Apple chlorotic leaf spot virus isolates

First Report of Tobacco Curly Shoot Virus Infecting Phaseolus Vulgaris in China

First Report of Actinidia Virus 1 Infecting Actinidia Chinensis in China

Complete genome analysis of two isolates of citrus leaf blotch virus in apple in Henan province of China

First Report of Malus domestica Virus A Infecting an Apple Tree in South Korea