First Report of Citrus Leaf Blotch Virus in Sweet Cherry.
J. Wang,D. Zhu,Y. Tan,X. Zong,H. Wei,Q. Liu
DOI: https://doi.org/10.1094/pdis-09-15-0965-pdn
IF: 4.5
2016-01-01
Plant Disease
Abstract:HomePlant DiseaseVol. 100, No. 5First Report of Citrus leaf blotch virus in Sweet Cherry PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Citrus leaf blotch virus in Sweet CherryJ. Wang, D. Zhu, Y. Tan, X. Zong, H. Wei, and Q. LiuJ. Wang, D. Zhu, Y. Tan, X. Zong, H. Wei, and Q. LiuAffiliationsAuthors and Affiliations J. Wang D. Zhu Y. Tan X. Zong H. Wei Q. Liu , Key Laboratory for Fruit Biotechnology Breeding of Shandong Province, Shandong Institute of Pomology, Tai'an, Shandong 271000, China. Published Online:25 Feb 2016https://doi.org/10.1094/PDIS-09-15-0965-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat In May 2014, five symptomatic sweet cherry trees (Prunus avium L. cv. Red-lamp), one with severe and four with mild mosaic symptoms, were found in the orchard at the suburb of Tai'an, Shandong Province, China. Total RNA was extracted from young leaf samples of the five symptomatic trees and three symptomless trees. Total RNA from the severely symptomatic tree was used for small RNA (sRNA) library construction. RNAs of <50 nt were purified from 6% polyacrylamide and sequenced on an Illumina HiSeq2000. Raw sequencing reads were analyzed using a CLC Genomics Workbench 7.5 (CLCbio, Aarhus, Denmark). After removal of the host sRNAs (database constructed by sweet cherry RNA-seq sequence libraries deposited in NCBI), 301 contigs (>100 nt) were assembled (length fraction, 0.94; similarity fraction, 1.0). BLASTn searches at NCBI (nonredundant nucleotide database) revealed contigs similar to Cherry virus A (CVA, 56 contigs), Prunus necrotic ringspot virus (PNRSV, 13 contigs), Little cherry virus 1 (LChV-1, two contigs) and Citrus leaf blotch virus (CLBV, three contigs). CVA, PNRSV, and LChV-1 infections of sweet cherry have been reported in China (Lu et al. 2015; Zong et al. 2014), but not CLBV. RT-PCR confirmed the CVA, PNRSV, and LChV-1 infections in the tree (Lu et al. 2015; Zong et al. 2014). To verify CLBV infection, primers (CLBV-F: GCCTACAGTTTAAGTGAGAGGCT and CLBV-R: GTCTAAAAGTTCTTAAAAGACATC) were designed according to the determined sequence and used to amplify a DNA fragment covering the movement protein (MP) and coat protein (CP) genes of CLBV by RT-PCR. A 2.9-kb DNA fragment was amplified from the tree with severe symptoms, from two of the four mild symptomatic trees, and from one of the symptomless trees. The amplicon from the tree exhibiting severe symptoms was cloned into pMD18-T (Takara, Dalian, China). Six clones were sequenced (Invitrogen, Beijing, China) and found to be 99.9 to 100% identical. One sequence was deposited in GenBank as Accession No. KT373979. This sequence was mapped to 3229 reads (approximately 26-fold coverage) with an average length of 23.6 nt (length fraction, 0.94; similarity fraction, 1.0). Phylogenetic analysis of the CP sequences of CLBV isolates in GenBank and other Betaflexiviridae family members using MEGA6.0 (Tamura et al. 2013) showed that the cherry isolate was most closely related to a citrus isolate (NC_003877, type isolate) and a kiwi isolate (JN900477). With other isolates, they formed a cluster distinct from other viruses of Betaflexiviridae. The CP gene of the cherry isolate shares 87.6% and 88.3% sequence identity with the citrus and kiwi isolates, respectively, indicating that it is a distinct variant of CLBV. Its MP gene shares higher identities (citrus, 95.6%; kiwi, 94.2%). Thus, CLBV can infect sweet cherry, and the sweet cherry isolate is a novel strain. To our knowledge, this is the first report of the CLBV infection in sweet cherry trees.References:Lu, M. G., et al. 2015. Plant Dis. 99:1191 https://doi.org/10.1094/PDIS-11-14-1200-PDN. Link, ISI, Google ScholarTamura, K., et al. 2013. Mol. Biol. Evol. 30:2725. https://doi.org/10.1093/molbev/mst197 Crossref, ISI, Google ScholarZong, X. J., et al. 2014. Sci. Hortic. (Amsterdam) 180:118. https://doi.org/10.1016/j.scienta.2014.10.017 Crossref, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 100, No. 5 May 2016SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 15 Apr 2016Published: 25 Feb 2016First Look: 17 Nov 2015Accepted: 12 Nov 2015 Pages: 1027-1027 Information© 2016 The American Phytopathological SocietyCited byComplete genome and molecular characterization of a putative novel citrivirus from Rudbeckia sp.8 October 2022 | Virus Genes, Vol. 59, No. 1Identification of Three Viruses Infecting Mulberry Varieties19 November 2022 | Viruses, Vol. 14, No. 11Development of a multiplex RT-PCR and the occurrence characteristics of viral diseases in sweet cherry trees in the Shandong Province, ChinaPhysiological and Molecular Plant Pathology, Vol. 121Citrus leaf blotch virusCABI Compendium, Vol. CABI CompendiumComplete genome analysis of two isolates of citrus leaf blotch virus in apple in Henan province of China7 September 2021 | Tropical Plant Pathology, Vol. 46, No. 6Occurrence and molecular characteristics of citrus leaf blotch virus from citrus in China based on coat protein genes8 September 2021 | Tropical Plant Pathology, Vol. 46, No. 6Autophagy Inhibits Intercellular Transport of Citrus Leaf Blotch Virus by Targeting Viral Movement Protein30 October 2021 | Viruses, Vol. 13, No. 11Partial biological and molecular characterization of a novel citrivirus from Nandina domestica23 February 2021 | Archives of Virology, Vol. 166, No. 5A Simulation of the Use of High Throughput Sequencing as Pre-Screening Assay to Enhance the Surveillance of Citrus Viruses and Viroids in the EPPO Region27 April 2021 | Agriculture, Vol. 11, No. 5Development and application of a reverse transcription loop-mediated isothermal amplification combined with lateral flow dipstick for rapid and visual detection of Citrus leaf blotch virus in kiwifruitCrop Protection, Vol. 143Complete genome sequence of citrus yellow spot virus, a newly discovered member of the family Betaflexiviridae2 September 2020 | Archives of Virology, Vol. 165, No. 11Citrus viruses and viroidsFirst report of citrus leaf blotch virus in Satsuma mandarin in Korea1 April 2019 | Journal of Plant Pathology, Vol. 101, No. 4Distribution and molecular characterization of Citrus leaf blotch virus from Actinidia in Shaanxi province, China15 January 2019 | European Journal of Plant Pathology, Vol. 154, No. 3Prunus avium (Sweet cherry)6 June 2020Molecular characterization of a novel citrivirus from citrus using next-generation sequencing17 September 2018 | Archives of Virology, Vol. 163, No. 12Complete genome sequences of four isolates of Citrus leaf blotch virus from citrus in ChinaJournal of Integrative Agriculture, Vol. 17, No. 3First Report of Citrus leaf blotch virus in Lemon in ChinaM. J. Cao, Y.-Q. Yu, X. Tian, F. Y. Yang, R. H. Li, and C. Y. Zhou12 May 2017 | Plant Disease, Vol. 101, No. 8