[The biopsy of human iris].

Y. Lai

Abstract:

What problem does this paper attempt to address?

Liver and spleen change in the living related liver donation.

T. Y. Chen,T. L. Huang,C. Chen,Y. Chen,H. Weng,C. Wang,T. Lee,Y. F. Cheng

DOI: https://doi.org/10.1016/S0041-1345(02)03804-6

IF: 1.014

2003-02-01

Transplantation Proceedings

Abstract:
Improving Medication Safety Based on Reports in Computerized Patient Safety Systems

A. Pitkänen,Susanna Teuho,Marjo Uusitalo,M. Kaunonen

DOI: https://doi.org/10.1097/CIN.0000000000000208

2016-03-01

Abstract:In recent years, patient safety has been a serious concern internationally. Medication in particular is a significant area in improving patient safety because medication errors are a crucial clinical problem. This study aimed to explore suggestions to improve medication safety reported via computerized patient safety systems in hospitals. The research data were retrospectively collected from the computerized patient safety incident reporting systems in one university hospital and two regional hospitals in Finland. Open-ended records concerning prescribing medicines (n = 136), dispensing medicines (n = 362), administering medicines to patients (n = 538), and documenting medication (n = 434) were included in the analysis. The data were analyzed by using inductive content analysis. Based on the study findings, there is a need to develop and standardize procedures related to all four parts of medication management process. Moreover, working environment, multiprofessional collaboration, and knowledge and skills of the professionals should be developed. Promoting medication safety in hospitals is an urgent challenge. The study results indicated that computerized patient safety incident reporting systems can provide important qualitative information to improve medication process to be safer.
[General service doing in psychiatry--conditions and wishes].

J. Beskow

1969-10-29

Abstract:
First Report of Citrus Leaf Blotch Virus in Sweet Cherry.

J. Wang,D. Zhu,Y. Tan,X. Zong,H. Wei,Q. Liu

DOI: https://doi.org/10.1094/pdis-09-15-0965-pdn

IF: 4.5

2016-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 100, No. 5First Report of Citrus leaf blotch virus in Sweet Cherry PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Citrus leaf blotch virus in Sweet CherryJ. Wang, D. Zhu, Y. Tan, X. Zong, H. Wei, and Q. LiuJ. Wang, D. Zhu, Y. Tan, X. Zong, H. Wei, and Q. LiuAffiliationsAuthors and Affiliations J. Wang D. Zhu Y. Tan X. Zong H. Wei Q. Liu , Key Laboratory for Fruit Biotechnology Breeding of Shandong Province, Shandong Institute of Pomology, Tai'an, Shandong 271000, China. Published Online:25 Feb 2016https://doi.org/10.1094/PDIS-09-15-0965-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat In May 2014, five symptomatic sweet cherry trees (Prunus avium L. cv. Red-lamp), one with severe and four with mild mosaic symptoms, were found in the orchard at the suburb of Tai'an, Shandong Province, China. Total RNA was extracted from young leaf samples of the five symptomatic trees and three symptomless trees. Total RNA from the severely symptomatic tree was used for small RNA (sRNA) library construction. RNAs of <50 nt were purified from 6% polyacrylamide and sequenced on an Illumina HiSeq2000. Raw sequencing reads were analyzed using a CLC Genomics Workbench 7.5 (CLCbio, Aarhus, Denmark). After removal of the host sRNAs (database constructed by sweet cherry RNA-seq sequence libraries deposited in NCBI), 301 contigs (>100 nt) were assembled (length fraction, 0.94; similarity fraction, 1.0). BLASTn searches at NCBI (nonredundant nucleotide database) revealed contigs similar to Cherry virus A (CVA, 56 contigs), Prunus necrotic ringspot virus (PNRSV, 13 contigs), Little cherry virus 1 (LChV-1, two contigs) and Citrus leaf blotch virus (CLBV, three contigs). CVA, PNRSV, and LChV-1 infections of sweet cherry have been reported in China (Lu et al. 2015; Zong et al. 2014), but not CLBV. RT-PCR confirmed the CVA, PNRSV, and LChV-1 infections in the tree (Lu et al. 2015; Zong et al. 2014). To verify CLBV infection, primers (CLBV-F: GCCTACAGTTTAAGTGAGAGGCT and CLBV-R: GTCTAAAAGTTCTTAAAAGACATC) were designed according to the determined sequence and used to amplify a DNA fragment covering the movement protein (MP) and coat protein (CP) genes of CLBV by RT-PCR. A 2.9-kb DNA fragment was amplified from the tree with severe symptoms, from two of the four mild symptomatic trees, and from one of the symptomless trees. The amplicon from the tree exhibiting severe symptoms was cloned into pMD18-T (Takara, Dalian, China). Six clones were sequenced (Invitrogen, Beijing, China) and found to be 99.9 to 100% identical. One sequence was deposited in GenBank as Accession No. KT373979. This sequence was mapped to 3229 reads (approximately 26-fold coverage) with an average length of 23.6 nt (length fraction, 0.94; similarity fraction, 1.0). Phylogenetic analysis of the CP sequences of CLBV isolates in GenBank and other Betaflexiviridae family members using MEGA6.0 (Tamura et al. 2013) showed that the cherry isolate was most closely related to a citrus isolate (NC_003877, type isolate) and a kiwi isolate (JN900477). With other isolates, they formed a cluster distinct from other viruses of Betaflexiviridae. The CP gene of the cherry isolate shares 87.6% and 88.3% sequence identity with the citrus and kiwi isolates, respectively, indicating that it is a distinct variant of CLBV. Its MP gene shares higher identities (citrus, 95.6%; kiwi, 94.2%). Thus, CLBV can infect sweet cherry, and the sweet cherry isolate is a novel strain. To our knowledge, this is the first report of the CLBV infection in sweet cherry trees.References:Lu, M. G., et al. 2015. Plant Dis. 99:1191 https://doi.org/10.1094/PDIS-11-14-1200-PDN. Link, ISI, Google ScholarTamura, K., et al. 2013. Mol. Biol. Evol. 30:2725. https://doi.org/10.1093/molbev/mst197 Crossref, ISI, Google ScholarZong, X. J., et al. 2014. Sci. Hortic. (Amsterdam) 180:118. https://doi.org/10.1016/j.scienta.2014.10.017 Crossref, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 100, No. 5 May 2016SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 15 Apr 2016Published: 25 Feb 2016First Look: 17 Nov 2015Accepted: 12 Nov 2015 Pages: 1027-1027 Information© 2016 The American Phytopathological SocietyCited byComplete genome and molecular characterization of a putative novel citrivirus from Rudbeckia sp.8 October 2022 | Virus Genes, Vol. 59, No. 1Identification of Three Viruses Infecting Mulberry Varieties19 November 2022 | Viruses, Vol. 14, No. 11Development of a multiplex RT-PCR and the occurrence characteristics of viral diseases in sweet cherry trees in the Shandong Province, ChinaPhysiological and Molecular Plant Pathology, Vol. 121Citrus leaf blotch virusCABI Compendium, Vol. CABI CompendiumComplete genome analysis of two isolates of citrus leaf blotch virus in apple in Henan province of China7 September 2021 | Tropical Plant Pathology, Vol. 46, No. 6Occurrence and molecular characteristics of citrus leaf blotch virus from citrus in China based on coat protein genes8 September 2021 | Tropical Plant Pathology, Vol. 46, No. 6Autophagy Inhibits Intercellular Transport of Citrus Leaf Blotch Virus by Targeting Viral Movement Protein30 October 2021 | Viruses, Vol. 13, No. 11Partial biological and molecular characterization of a novel citrivirus from Nandina domestica23 February 2021 | Archives of Virology, Vol. 166, No. 5A Simulation of the Use of High Throughput Sequencing as Pre-Screening Assay to Enhance the Surveillance of Citrus Viruses and Viroids in the EPPO Region27 April 2021 | Agriculture, Vol. 11, No. 5Development and application of a reverse transcription loop-mediated isothermal amplification combined with lateral flow dipstick for rapid and visual detection of Citrus leaf blotch virus in kiwifruitCrop Protection, Vol. 143Complete genome sequence of citrus yellow spot virus, a newly discovered member of the family Betaflexiviridae2 September 2020 | Archives of Virology, Vol. 165, No. 11Citrus viruses and viroidsFirst report of citrus leaf blotch virus in Satsuma mandarin in Korea1 April 2019 | Journal of Plant Pathology, Vol. 101, No. 4Distribution and molecular characterization of Citrus leaf blotch virus from Actinidia in Shaanxi province, China15 January 2019 | European Journal of Plant Pathology, Vol. 154, No. 3Prunus avium (Sweet cherry)6 June 2020Molecular characterization of a novel citrivirus from citrus using next-generation sequencing17 September 2018 | Archives of Virology, Vol. 163, No. 12Complete genome sequences of four isolates of Citrus leaf blotch virus from citrus in ChinaJournal of Integrative Agriculture, Vol. 17, No. 3First Report of Citrus leaf blotch virus in Lemon in ChinaM. J. Cao, Y.-Q. Yu, X. Tian, F. Y. Yang, R. H. Li, and C. Y. Zhou12 May 2017 | Plant Disease, Vol. 101, No. 8
Kyuri green mottle mosaic virus detected for the first time in Turkey

Selin Ceren Balsak

DOI: https://doi.org/10.1007/s13314-023-00504-3

2023-06-09

Australasian Plant Disease Notes

Abstract:Turkey is among the top 10 producers of cucumber, melon, watermelon, and squash in the world. Lately, seed-borne viruses have become a major issue in greenhouse and field-grown cucurbits. In this study, the incidence of kyuri green mottle mosaic virus (KGMMV) was determined in seeds from various species (cucumber, melon, watermelon, summer squash, bottle gourd, winter squash) of Cucurbitaceae . KGMMV detection in a total of 20 seed lots of each cucurbit species was done by enzyme-linked immunosorbent assay (ELISA) and RT-PCR. The highest virus incidence was 45% in melon followed by 25% in cucumber and 10% in squash. To the best of our knowledge, this is the first report of KGMMV in cucurbit crops in Turkey and this highlights the potential risk of KGMMV to commercial cucurbit seed lots.
First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China

Xinying Yang,Qiangsheng Xu,Zheng Liu,Changyong Zhou,Mengji Cao

DOI: https://doi.org/10.1094/PDIS-06-22-1344-PDN

2022-12-05

Abstract:Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.
Incidence and Epidemiology of Citrus Viroids in Greece: Role of Host and Cultivar in Epidemiological Characteristics

Matthaios M Mathioudakis,Nikolaos Tektonidis,Antonia Karagianni,Louiza Mikalef,Pedro Gómez,Beata Hasiów-Jaroszewska

DOI: https://doi.org/10.3390/v15030605

2023-02-22

Viruses

Abstract:Viroids represent a threat to the citrus industry and also display an intricate matter for citrus tristeza virus (CTV) control as most of the commercial citrus rootstocks that are resistant/tolerant to CTV appear to be highly susceptible to viroid infection. Therefore, a detailed knowledge of the viroid's incidence and distribution, along with the assessment of unexplored epidemiological factors leading to their occurrence, are necessary to further improve control measures. Herein, a large-scale epidemiological study of citrus viroids in five districts, 38 locations and 145 fields in Greece is presented, based on the analysis of 3005 samples collected from 29 cultivars of six citrus species. We monitored the occurrence of citrus exocortis (CEVd), hop stunt (HSVd), citrus dwarfing (CDVd), citrus bark cracking (CBCVd), and citrus bent leaf (CBLVd) viroids, and addressed their epidemiological patterns and factors shaping their population structure. Our results show a high frequency and wide distribution of four viroids in all areas and in almost all hosts, whereas CBLVd occurrence was restricted to Crete. Mixed infections were found in all districts in which a wide spread of viroids was observed. We identified a potential pathogens' different preferences that could be partially explained by the host and cultivar, including the type of infection (single or mixed) and the number of viroids in the mixed infections. Overall, this work provides the first detailed epidemiological study on citrus viroids, enriching our knowledge for the implementation, production, and distribution of certified citrus propagative material, and the development of sustainable control strategies.
Monoclonal Antibody-Based Serological Detection of Citrus Yellow Vein Clearing Virus in Citrus Groves

Liu Zhen,Sunzhu Yuan-ji,Zhou Xue-ping,Hong Jian,Wu Jian-xiang

DOI: https://doi.org/10.1016/s2095-3119(16)61475-2

2017-01-01

Abstract:Citrus yellow vein clearing virus (CYVCV) is considered as the causal agent of Citrus yellow vein clearing disease and be-longs to the genus Mandarivirus in the family Alphaflexiviridae. Capsid protein (CP) of CYVCV Chongqing isolate (CYVCV-CQ) was produced using a prokaryotic expression system and used as the immunogen for monoclonal antibody (MAb) production. Four highly specific and sensitive murine MAbs and one polyclonal antibody were prepared in this study. Titers of the four MAbs in ascites fluids ranged from 10−6 to 10−7 as determined by indirect enzyme-linked immunosorbent assay (ELISA). Three serological assays, including dot enzyme-linked immunosorbent assay (dot-ELISA), tissue blot-ELISA, and double-antibody sandwich (DAS)-ELISA, were developed for quick and reliable detections of CYVCV in citrus samples. The developed dot-ELISA and DAS-ELISA methods could detect CYVCV in the infected citrus leaf crude extracts diluted at 1:2 560 and 1:10 240 (w/v, g mL−1), respectively. The detection result of 125 citrus leaf samples collected from citrus groves in Yunnan Province and Chongqing Municipality of China showed that approximately 36% samples were positive for CYVCV. This virus was, however, not detected in any sample collected from Zhejiang or Jiangxi Province, China.
A Destructive New Disease of Citrus in China Caused by Cryptosporiopsis Citricarpa Sp. Nov.

Li Zhu,Xinghong Wang,Feng Huang,Jinze Zhang,Hongye Li,Dekuan Ding,Kevin D. Hyde

DOI: https://doi.org/10.1094/pdis-09-11-0775

IF: 4.5

2012-01-01

Plant Disease

Abstract:Defoliation, dieback and mortality of Satsuma mandarin (Citrus unshiu), as well as kumquat (Fortunella margarita), in Chenggu County, Shaanxi Province, China was first noticed in 2006 and caused substantial economic losses to citrus production. The incidence of leaves infected approached 100% in some badly infected orchards. The disease prevailed only in late winter and early spring, where early symptoms were rounded and target-like spots on leaves. The disease was named target spot. Black conidiomata were observed on the upper surface of the leaves. A Cryptosporiopsis species was consistently recovered from the infected leaves, shoots, and branches. Koch's postulates were fulfilled by inoculating the conidial suspension of Cryptosporiopsis sp. onto the leaves of Satsuma mandarin. Phylogenetic analysis based on LSU sequence data indicated that this taxon clustered in Cryptosporiopsis (teleomorph: Neofabraea, Dermateaceae). Phylogenetic analysis based on ITS, SSU, and TUB indicated that the isolates of Cryptosporiopsis sp. constituted a distinct clade. Further study also demonstrated that this taxon was morphologically distinct from other species of Cryptosporiopsis, thus suggesting it might belong to an undescribed species. The name Cryptosporiopsis citricarpa sp. nov. is given to accommodate the fungal pathogen in this study.
Genotype Sequencing and Phylogenetic Analysis Revealed the Origins of Citrus Yellow Vein Clearing Virus California Isolates

Yong-Duo Sun,Raymond Yokomi

DOI: https://doi.org/10.3390/v16020188

2024-01-27

Viruses

Abstract:The Citrus yellow vein clearing virus (CYVCV) causes a viral disease that has been reported in some citrus-growing regions in countries in Eurasia including Pakistan, India, Türkiye, Iran, China, and South Korea. Recently, CYVCV was detected in a localized urban area in a town in the middle of California's citrus-growing region and marks the first occurrence of the virus in North America. CYVCV has been reported to be spread by aphid and whitefly vectors and is graft and mechanically transmitted. Hence, it is an invasive pathogen that presents a significant threat to the California citrus industry, especially lemons, which are highly symptomatic to CYVCV. To elucidate the origin of the CYVCV California strain, we used long-read sequencing technology and obtained the complete genomes of three California CYVCV isolates, CA1, CA2, and CA3. The sequences of these isolates exhibited intergenomic similarities ranging from 95.4% to 97.4% to 54 publicly available CYVCV genome sequences, which indicated a relatively low level of heterogeneity. However, CYVCV CA isolates formed a distinct clade from the other isolates when aligned against other CYVCV genomes and coat protein gene sequences as shown by the neighbor network analysis. Based on the rooted Maximum Likelihood phylogenetic trees, CYVCV CA isolates shared the most recent common ancestor with isolates from India/South Asia. Bayesian evolutionary inferences resulted in a spatiotemporal reconstruction, suggesting that the CYVCV CA lineage diverged from the Indian lineage possibly around 1995. This analysis placed the origin of all CYVCV to around 1990, with South Asia and/or Middle East as the most plausible geographic source, which matches to the first discovery of CYVCV in Pakistan in 1988. Moreover, the spatiotemporal phylogenetic analysis indicated an additional virus diffusion pathway: one from South Asia to China and South Korea. Collectively, our phylogenetic inferences offer insights into the probable dynamics of global CYVCV dissemination, emphasizing the need for citrus industries and regulatory agencies to closely monitor citrus commodities crossing state and international borders.

virology
First Report of Cucurbit Chlorotic Yellows Virus in Cucumber, Melon, and Watermelon in China

Qinsheng Gu,Y. H. Liu,Y. H. Wang,Wei-Guo Huang-Fu,Huihui Gu,Lihui Xu,Fengming Song,Judith K. Brown

DOI: https://doi.org/10.1094/pdis-07-10-0550

IF: 4.5

2011-01-01

Plant Disease

Abstract:Systemic foliar chlorosis of melon, watermelon, and cucumber plants grown in plastichouses was first observed in Shanghai, China in 2008. By the end of October 2009, this symptom had become prevalent across 13,000 ha of plastichouses in Shanghai, Ningbo in Zhejiang Province, and Shouguang in Shandong Province. By mid-October, disease incidence ranged from 50 to 100% and losses were estimated between 10 and 20% across 100 plastichouses. Initial disease symptoms were chlorosis beginning at the base and middle portion of the older leaves followed by development of chlorotic spots on the lamina. Within 4 to 5 days, the entire leaf lamina was bright yellow and the veins remained green. The whitefly, Bemisia tabaci, was frequently observed colonizing plants in all plastichouses included in this study. Leaf samples were collected from six symptomatic cucumber, melon, and watermelon plants from individual plastichouses in Shanghai, Ningbo, and Shouguang. A pair of degenerate primers, F-5′-GGN TTA GAN TTC GGN ACN AC-3′ and R-5′-TCA AAN GTN CCN CCN CCN AA-3′, that were specific for the genera Crinivirus and Closterovirus, family Closteroviridae (2) were used to amplify a 636-bp fragment of the viral heat shock protein 70 gene (Hsp70). A PCR product of the expected size was amplified from RNA extracted with TaKaRa RNAiso Reagent (TaKaRa, Dalian, China) from symptomatic leaf samples: 3 of 3 melon, 2 of 2 watermelon, and 1 of 1 cucumber, and from 5 of 5 Bemisia tabaci adults collected from plants in five plastichouses in Shanghai, Ningbo, and Shouguang. No PCR product was obtained from RNA extracted from cucumber leaves grown in a virus-free facility at the Fruit Research Institute, Zhengzhou. PCR products were sequenced from representative plants samples and the sequences were submitted to GenBank (Nos. GU721105 to GU721107, GU72118 to GU721110, and GU721111. The six Hsp70 sequences shared 99.8 to 100% identity with Cucurbit chlorotic yellows virus (CCYV) (GenBank No. AB523789) from Japan. Using the complete CCYV sequence (1), PCR primers were designed to amplify the complete CCYV coat protein (Cp): Cp F-5′-CGCAATCAATAAGGCGGCGACC-3′ and Cp R-5′-ACTACAACCTCCCGGTGCCAACT-3′ (804 bp), minor Cp (Cpm): Cpm-F-5′-TGATGAANTGCCANGCTNTGAAA-3′ and Cpm-R5′-ACAANTGATTCACATTNACAAT-3′ (1,632 bp); and Hsp70: Hsp F-5′-TGCAACCGATGTCAGGTTCAGCG-3′ with Hsp R-5′-TGGATAATTGGTCACGACCTCCAGT-3′ (1,947 bp). One PCR amplicon was obtained for each target gene using RNA extracted from a cucumber collected in Ningbo. Three of the PCR amplicons were cloned and the DNA sequence was determined. A representative sequence for each gene was deposited in GenBank as: cp (HM581658), cpm (HM581657), and hsp70 (HM581659). The cp, cpm, and hsp70 sequences shared 99.7, 99.9, and 99.9% nt identity with the respective genes of CCYV (AB523789), whereas they shared only 62.5, 49.9, and 69.6% identity with the respective gene sequences for Cucurbit yellow stunting disorder virus (CYSDV; NC004810), suggesting the two viruses are divergent crinivirus species. Although this virus was first reported to infect cucurbits in Japan in 2009 (1), to our knowledge, this is the first report of CCYV in China. Eradication and management efforts are therefore paramount to reducing the spread of the disease. References: (1) M. Okuda et al. Phytopathology 100:560, 2010. (2) T. Tian et al. Phytopathology 86:1167, 1996.
First report of citrus leaf blotch virus infecting Viburnum lentago in South Korea

Myung-Hwi Kim,Hee-Seong Byun,Hae-Ryun Kwak,Sun-Jung Kwon,Jang-Kyun Seo

DOI: https://doi.org/10.1094/PDIS-11-22-2640-PDN

2023-02-03

Abstract:Viburnum lentago (family Adoxaceae) is a perennial plant species native to northeastern United States and southern Canada. Globally, V. lentago is a popular garden plant due to its abundant flowers and beautiful autumnal color. V. lentago is also commercially cultivated for medicinal purposes because its roots and fruits can be used in herbal preparations (Jiao et al. 2021). In June 2022, virus-like symptoms of vein chlorosis and yellowing were observed in the leaves of many V. lentago trees planted in a public park in Wonju, South Korea. Leaf samples were collected from five symptomatic V. lentago trees. To identify the causal agent(s) of the virus-like symptoms, total RNA was isolated from one sample using PureLink® RNA Mini Kit (Invitrogen, USA) and subjected to library construction using Illumina TruSeq RNA Sample Preparation Kit v2 (Illumina, Inc., USA). RNA-Seq was performed using an Illumina NovaSeq 6000 system (Macrogen, Korea). De novo assembly of 118,878,556 quality-filtered reads was performed using the Trinity pipeline (Kwon et al. 2018), yielding 296,109 contigs. BLASTn and BLASTx analyses of the contigs against the GenBank viral reference database identified only one large contig (8,816 nt) containing a 26-nt poly(A) tail of viral origin. This contig had a maximum nucleotide identity of 85.53 % (with 99 % coverage) with isolate HZ (accession No. MH427034) of citrus leaf blotch virus (CLBV; genus Citrivirus, family Betaflexiviridae), suggesting that the collected sample was infected with CLBV. All collected V. lentago samples were tested using RT-PCR with CLBV-specific primers (CLBV-Det-Fw 5'-AACGAGGCCAATTCTGCTAT-3' and CLBV-Det-Rv 5'-GACTGCTTGACTAACAC-CCA-3'). All samples were positive for CLBV. For biological indexing, sap from the symptomatic V. lentago leaves was mechanically inoculated to indicator plants, including Nicotiana benthamiana, N. occidentalis, N. tabacum, Datura stramonium, Chenopodium quinoa, Vigna unguiculata, and V. lentago. Three months later, only V. lentago developed the same vein chlorosis symptoms observed in the collected samples, and no other tested plants exhibited obvious symptoms. Further, only V. lentago sample tested positive for CLBV using RT-PCR analysis. To determine the complete genome sequence of the CLBV V. lentago isolate, the contig sequence was confirmed by de novo sequencing of the RT-PCR products amplified using CLBV-specific primers. The 5' terminal sequence of the contig was determined using the 5' rapid amplification of cDNA ends method (Seo et al. 2015). The full-length sequence of CLBV isolated from V. lentago was 8,795 nt in length (excluding poly(A) tail), and deposited in GenBank under the accession number OP751940. Although numerous isolates of CLBV have been identified in various plant species, including citrus, kiwi, and lemon plants (Cao et al. 2017), the V. lentago isolate is likely a distinct variant because its CP gene has a maximum nucleotide identity of 85.53 % with that of a kiwi isolate (MH339916). With little information available on viral diseases infecting V. lentago, this is the first identified and completely sequenced CLBV infecting V. lentago. Significantly, V. lentago plants infected with CLBV did not flower throughout the summer period, reducing their value as an ornamental plant. Furthermore, V. lentago might have acted as an intermediate host to transfer CLBV to other crops such as citrus. To the best of our knowledge, this is the first report of CLBV infecting V. lentago in South Korea and the world.
A comparative study of nursing staff, care recipients' and their relatives' perceptions of quality of older people care.

H. Hasson,J. Arnetz

DOI: https://doi.org/10.1111/j.1748-3743.2009.00186.x

2010-03-01

International Journal of Older People Nursing

Abstract:BACKGROUND Comparisons of different stakeholders' ratings of the quality of older people care can help to drive quality improvement. AIM The aim was to compare staff, older care recipients' and their relatives' quality of care ratings. DESIGN Cross-sectional questionnaire surveys in 2003 and 2004, using a repeated measures design on an organizational level. METHODS Nursing staff, care recipients and relatives in two older people care organizations were included. The ratings of an overall quality grade, information, activities, general care and staff skills were compared between the respondent groups. RESULTS Care recipients in both organizations rated the overall quality grade significantly higher than nursing staff and relatives. Staff ratings of the information given to care recipients were significantly more positive than care recipients' and relatives' ratings. All three groups gave lowest ratings to the quality of activities offered to care recipients, with lowest ratings from nursing staff. CONCLUSIONS Concurrent measurements of staff, care recipients and relatives' care quality perceptions can provide a broad evaluation of an organization's strength and limitations. Relevance to clinical practice. Staff, care recipients' and relatives' perceptions can be useful for older people care organizations and decision makers in developing care processes and outcomes of care.
Distribution and characterization of Colletotrichum species associated with Citrus anthracnose in eastern Mediterranean region of Turkey

Aysun Uysal,Şener Kurt,Vladimiro Guarnaccia

DOI: https://doi.org/10.1007/s10658-022-02462-5

2022-02-14

European Journal of Plant Pathology

Abstract:Citrus are economically important fruit crops produced worldwide. Anthracnose, post bloom fruit drop, and stem-end rot of fruit caused by Colletotrichum species are diseases that seriously threatens citrus production in Turkey. Surveys conducted in 2016–2017 allowed the detection of typical symptoms of anthracnose of the visited fields (126 among 203) in the citrus production area of the Eastern Mediterranean region of Turkey. A total of 194 Colletotrichum strains were obtained from different citrus cultivars, including lemon (85), mandarin (73), orange (30), sour orange (1) and grapefruit (5) and different plant tissues (twigs (90), leaves (84) and fruits (20)). A multi-locus phylogeny was established based on four genomic loci (ITS, GAPDH, ACT, CHS1), and the morphological characters of the isolates were determined. Based on morphological characters and phylogenetic analysis, isolates were identified as belonging to C. gloeosporioides and C. karsti. Pathogenicity trials showed that, both species were able to colonise leaves, twigs, and fruits of the susceptible cultivar Interdonato of Citrus limon. Symptoms that developed on inoculated tissues were similar to those observed in the field on naturally infected citrus plants. Pathogenicity trials showed that C. gloeosporioides was more virulent on twigs and leaves, and C. karsti on fruits. To the best of our knowledge, this is the most comprehensive study on identification and characterization of C. gloeosporioides and C. karsti associated with citrus anthracnose in Turkey.

plant sciences,horticulture,agronomy
Biological and molecular characterization of citrus tatter leaf virus in Taiwan

L. Chang,C.-Y. Lin,Y.-H. Lin,H.-J. Cheng,M.-L. Wu,T.-H. Hung

DOI: https://doi.org/10.1111/ppa.12806

2018-01-29

Plant Pathology

Abstract:Citrus tatter leaf virus (CTLV) causes chlorotic leaves with bud union incompatibility in citrus scion and its current incidence in Taiwan is 65%. However, the burden of infection has long been underestimated due to its common latency, and the serious threat of tatter leaf disease should be investigated and addressed without delay. Here, the biological characteristics and genome sequences of Taiwanese isolates are evaluated. Full‐length sequencing and phylogenetic analysis of three local isolates revealed similarities with isolates from neighbouring countries, indicating their possible origins. Two mild isolates obtained from Liuchen sweet orange (LCd‐NA‐1) and kumquat (Kq‐6‐2‐46) were inoculated on indicator plants and exhibited differences in foliar symptom expression and temperature tolerance compared with foreign isolates causing severe disease. Improved quantitative PCR‐based detection methods using redesigned primer pairs indicated high sensitivity and specificity for both local and foreign isolates. Similar but delayed systemic symptoms were observed when wildtype virus in vitro transcripts generated from a full‐length infectious clone of the Ponkan mandarin isolate (pCTLV‐Pk‐8) were inoculated on Chenopodium quinoa. These symptoms were unevenly distributed and highly concentrated on the inoculated sides of leaves and top leaves. A single codon mutation (U5642C) in the coat protein transcription start site in the pCTLV‐Pk‐8 sequence resulted in defective systemic infection, indicating a role for the coat protein in viral movement. The combination of biological assays, improved detection and infectious clone construction provides comprehensive information and a foundation for citrus virus management and further research.

plant sciences,agronomy
Organotin concentrations in three intertidal neogastropods from the coastal waters of Taiwan.

Li-Lian Liu,S. J. Chen,W. Peng,J. Hung

DOI: https://doi.org/10.1016/S0269-7491(97)00112-7

IF: 8.9

Environmental Pollution

Abstract:
Molecular detection of Citrus exocortis viroid (CEVd), Citrus viroid-III (CVd-III), and Citrus viroid-IV (CVd-IV) in Palestine

Aswar Abualrob,Osama Alabdallah,Raied Abou Kubaa,Sabri M. Naser,Raed Alkowni

DOI: https://doi.org/10.1038/s41598-023-50271-5

IF: 4.6

2024-01-04

Scientific Reports

Abstract:Citrus hosts various phytopathogens that have impacted productivity, including viroids. Missing data on the status of viroids in citrus in Palestine were not reported. This study was aimed to detect any of Citrus exocortis viroid (CEVd), Citrus viroid-III (CVd-III), and Citrus viroid-IV (CVd-IV) in the Palestinian National Agricultural Research Center (NARC) germplasm collection Field inspections found symptoms such as leaf epinasty; vein discoloration, and bark cracking on various citrus varieties. RT-PCR revealed a significant prevalence of CVd-IV; CEVd and CVd-III (47%, 31%, and 22%; respectively). CVd-III variants with 91.3% nucleic acid sequence homology have been reported. The sequence of each viroid were deposited in GenBank as (OP925746 for CEVd, OP902248 and OP902249 for CVd-III-PS-1 and -PS-2 isolates, and OP902247 for CVd-IV). This was the first to report three of citrus viroids in Palestine, appealing to apply of phytosanitary measures to disseminate healthy propagating materials free from viroids.

multidisciplinary sciences
Fusarium spp. are Responsible for Shoot Canker of Kumquat in China

Li Zhu,Guoqing Chen,XiaoLong Zhao,ChongLing Deng,Kevin David Hyde,Hongye Li

DOI: https://doi.org/10.1111/jph.12019

2013-01-01

Journal of Phytopathology

Abstract:Shoot and branch canker and tree decline of kumquat (Fortunella margarita cv. Guban) were recorded in Yangshuo County, Guilin City, in the Guangxi Zhuang Autonomous Region of China during 20082011. Fusarium oxysporum and a new Fusarium species within the Gibberella fujikuroi complex (Fusarium sp. GLB1) were isolated repeatedly from the infected shoots and branches. Species identifications were verified by their high translation elongation factor 1-alpha (TEF1) sequence similarity with those of the species epitypes. Koch's postulates were fulfilled on kumquat (cv. Guban) and mandarin establishing pathogenicity. To our knowledge, this is the first report of Fusarium shoot canker disease caused by F. oxysporum and Fusarium sp. on kumquat.
Uncovering the presence of CVPD disease in citrus varieties of South Sulawesi, Indonesia: A molecular approach

Mustika Tuwo,Tutik Kuswinanti,Andi Nasruddin,Elis Tambaru

DOI: https://doi.org/10.1016/j.jgeb.2023.100332

Abstract:Background: The citrus vein phloem degeneration (CVPD) disease is one of important diseases that infects citrus plants and threatens global citrus production and quality due to its severe symptoms and rapid spread. In the 2000s, South Sulawesi Province as one of the citrus producers in Indonesia reported CVPD infection. To date, it is still uncertain as to whether the citrus production center has already been rid of the CVPD infection, keeping in mind the low prevalence of certified citrus saplings use and sub-optimal management of plantations by farmers. Results: Field observation results revealed varied chlorosis symptoms from young to productive cultivation, which certainly makes it appealing to find out the presence of the causative bacterium, as it has yet to be known whether all the leaves with positive chlorosis symptoms carry the bacterium Candidatus Liberibacter asiaticus. Citrus saplings that appear healthy may carry CVPD pathogens as the incubation period of CVPD pathogens in the host plant spans three to five months. Thus, it is necessary to find the right, rapid way to detect the presence of CVPD pathogens in the citrus plant. The most effective method to use is PCR as the bacterium Candidatus L. asiaticus is non-culturable in vitro, but it is detectable using 16S rDNA. Sampling of leaves with CVPD symptoms was conducted purposively from eight varieties in five citrus cultivation locations, i.e., Pangkep, Sidrap, Bantaeng, Luwu Utara, and Kepulauan Selayar Regencies. DNA isolation was carried out following the Genomic DNA Kit (Geneaid) procedure, followed by detection using the specific pathogenic primer pair OI1 (5' GCG CGT ATG CAA TAC GAG CGG C 3') and OI2c (5' GCC TCG CGA CTT CGC AAC CCA T 3'). Conclusion: The PCR visualization result shows seven positive samples with DNA fragments measuring 1160 bp. The seven samples were samples of the Key lime, tangerine, Mandarin (cv. batu 55), and Mandarin (cv. selayar), each being derived from Sidrap, Luwu Utara, and Bantaeng. The average disease incidence rate was 66.56 %. Based on the field observation results, the insect vector Diaphorina citri was nowhere to be found in the five citrus cultivation locations in South Sulawesi.
Identification of an emerging cucumber virus in Taiwan using Oxford nanopore sequencing technology

Zi-Xuan Dong,Chian-Chi Lin,Yuh-Kun Chen,Chia-Cheng Chou,Tsung-Chi Chen

DOI: https://doi.org/10.1186/s13007-022-00976-x

IF: 5.827

2022-12-22

Plant Methods

Abstract:Background: In June 2020, severe symptoms of leaf mosaic and fruit malformation were observed on greenhouse-grown cucumber plants in Xizhou Township of Changhua County, Taiwan. An unknown virus, designated CX-2, was isolated from a diseased cucumber sample by single lesion isolation on Chenopodium quinoa leaves. Identification of CX-2 was performed. Moreover, the incidence of cucumber viruses in Taiwan was also investigated. Methods: Transmission electron microscopy was performed to examine virion morphology. The portable MinION sequencer released by Oxford Nanopore Technologies was used to detect viral sequences in dsRNA of CX-2-infected leaf tissue. The whole genome sequence of CX-2 was completed by Sanger sequencing and analyzed. Reverse transcription-polymerase chain reaction (RT-PCR) with species-specific primers and indirect enzyme-linked immunosorbent assay (ELISA) with anti-coat protein antisera were developed for virus detection in the field [see Additional file 1]. Results: Icosahedral particles about 30 nm in diameter were observed in the crud leaf sap of CX-2-infected C. quinoa plant. The complete genome sequence of CX-2 was determined as 4577 nt long and shared 97.0-97.2% of nucleotide identity with that of two cucumber Bulgarian latent virus (CBLV) isolates in Iran and Bulgaria. Therefore, CX-2 was renamed CBLV-TW. In 2020-2022 field surveys, melon yellow spot virus (MYSV) had the highest detection rate of 74.7%, followed by cucurbit chlorotic yellows virus (CCYV) (32.0%), papaya ringspot virus virus watermelon type (PRSV-W) (10.7%), squash leaf curl Philippines virus (SLCuPV) (9.3%), CBLV (8.0%) and watermelon silver mottle virus (WSMoV) (4.0%). Co-infection of CBLV and MYSV could be detected in field cucumbers. Conclusion: The emerging CBLV-TW was identified by nanopore sequencing. Whole genome sequence analysis revealed that CBLV-TW is closely related, but phylogenetically distinct, to two known CBLV isolates in Bulgaria and Iran. Detection methods including RT-PCR and indirect ELISA have been developed to detect CBLV and to investigate cucumber viruses in central Taiwan. The 2020-2022 field survey results showed that MYSV and CCYV were the main threats to cucumbers, with CBLV, SLCuPV and WSMoV were occasionally occurring.

[The biopsy of human iris].

Liver and spleen change in the living related liver donation.

Improving Medication Safety Based on Reports in Computerized Patient Safety Systems

[General service doing in psychiatry--conditions and wishes].

First Report of Citrus Leaf Blotch Virus in Sweet Cherry.

Kyuri green mottle mosaic virus detected for the first time in Turkey

First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China

Incidence and Epidemiology of Citrus Viroids in Greece: Role of Host and Cultivar in Epidemiological Characteristics

Monoclonal Antibody-Based Serological Detection of Citrus Yellow Vein Clearing Virus in Citrus Groves

A Destructive New Disease of Citrus in China Caused by Cryptosporiopsis Citricarpa Sp. Nov.

Genotype Sequencing and Phylogenetic Analysis Revealed the Origins of Citrus Yellow Vein Clearing Virus California Isolates

First Report of Cucurbit Chlorotic Yellows Virus in Cucumber, Melon, and Watermelon in China

First report of citrus leaf blotch virus infecting Viburnum lentago in South Korea

A comparative study of nursing staff, care recipients' and their relatives' perceptions of quality of older people care.

Distribution and characterization of Colletotrichum species associated with Citrus anthracnose in eastern Mediterranean region of Turkey

Biological and molecular characterization of citrus tatter leaf virus in Taiwan

Organotin concentrations in three intertidal neogastropods from the coastal waters of Taiwan.

Molecular detection of Citrus exocortis viroid (CEVd), Citrus viroid-III (CVd-III), and Citrus viroid-IV (CVd-IV) in Palestine

Fusarium spp. are Responsible for Shoot Canker of Kumquat in China

Uncovering the presence of CVPD disease in citrus varieties of South Sulawesi, Indonesia: A molecular approach

Identification of an emerging cucumber virus in Taiwan using Oxford nanopore sequencing technology