Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Omission of Previous Publications by an Author Should Be Corrected

Corrigendum for “A Novel Kinase Subverts Aluminium Resistance by Boosting Ornithine Decarboxylase‐dependent Putrescine Biosynthesis”

Correction: Corrigendum: Autophagy-associated alpha-arrestin signaling is required for conidiogenous cell development in Magnaporthe oryzae

Correction To: Early Presence of Anti-Angiogenesis-related Adverse Events As a Potential Biomarker of Antitumor Efficacy in Metastatic Gastric Cancer Patients Treated with Apatinib: a Cohort Study

Correction To: Therapeutic Efficacy, Pharmacokinetic Profiles, and Toxicological Activities of Humanized Antibody-Drug Conjugate Zt/g4-MMAE Targeting RON Receptor Tyrosine Kinase for Cancer Therapy

Correction: Corrigendum: Lysine Acetylation and Succinylation in HeLa Cells and Their Essential Roles in Response to UV-induced Stress

Erratum for Wang et al., "Promiscuous Enzymes Cause Biosynthesis of Diverse Siderophores in Shewanella oneidensis".

Corrigendum to: GSK-3 Inhibitors in the Regulation and Control of Colon Carcinoma

[Retracted] Glutathione peroxidase 2 overexpression promotes malignant progression and cisplatin resistance of KRAS‐mutated lung cancer cells

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

Erratum to: Cytokine and human leukocyte antigen (HLA) profile for graft-versus-host disease (GVHD) after organ transplantation

Erratum to: Fluorescent glycan nanoparticle-based FACS assays for the identification of genuine drug-resistant cancer cells with differentiation potential

[Corrigendum] microRNA‐181a‐5p functions as an oncogene in renal cell carcinoma

Correction: Corrigendum: Differential Developmental Requirement and Peripheral Regulation for Dermal Vγ4 and Vγ6T17 Cells in Health and Inflammation

[Corrigendum] Effect of STC2 gene silencing on colorectal cancer cells

Correction: Cheng et al. Glutathione S-Transferases S1, Z1 and A1 Serve as Prognostic Factors in Glioblastoma and Promote Drug Resistance through Antioxidant Pathways. Cells 2022, 11, 3232

Corrigendum to "Dual Effects of Cellular Immunotherapy in Inhibition of Virus Replication and Prolongation of Survival in HCV-Positive Hepatocellular Carcinoma Patients"

[Corrigendum] Role of 4‑aminobutyrate Aminotransferase (ABAT) and the Lncrna Co‑expression Network in the Development of Myelodysplastic Syndrome

Correction: Xiang, S., Et Al. Schisandrin B Induces Apoptosis and Cell Cycle Arrest of Gallbladder Cancer Cells. Molecules 2014, 19, 13235–13250

Corrigendum to: Progress of Angiogenesis Signal Pathway and Antiangiogenic Drugs in Nasopharyngeal Carcinoma

Corrigendum to "Gene mutations in newly diagnosed multiple myeloma patients detected by next-generation sequencing technology" [ Cancer Pathog Ther. 2024;2:205-211]