Abstract:BACKGROUND:Concanavalin A (ConA)-induced hepatitis is an experimental murine model mirroring the pathology of human autoimmune hepatitis.AIM:To investigate the effects of intrasplenically transplanted fetal hepatocytes (BNL.CL2) transfected with recombinant adenovirus vector expressing the IL-18 binding protein (IL-18BP) and IL-4 fusion protein on ConA-induced hepatitis in mice.METHODS:Ad-IL-18BP/IL-4 was used to infect BNL.CL2 cells. IL-4 and IL-18BP fusion protein expression were detected by ELISA and Western blotting. BNL.CL2 cells infected with Ad-IL-18BP/IL-4 were intrasplenically transplanted into mice. After 10 days, mice were injected with ConA (15 mg/kg), and sacrificed 18 hours later. Liver injury was assessed by serum transaminase and liver histology. TNF-α, IL-18, IL-4, IL-10, IL-12p70 and monocyte-chemoattracting protein (MCP)-1 levels in serum and liver homogenates were detected by ELISA. Signaling molecules in liver homogenates were analyzed by Western blotting.RESULTS:Ad-IL-18BP/IL-4 effectively expressed the IL-18BP/IL-4 fusion protein for more than 14 days in BNL.CL12 cells. Treatment of mice with Ad-IL-18BP/IL-4-BNL.CL2 before ConA injection significantly reduced the elevated plasma levels of transaminases compared with ConA control groups. TNF-α, IL-18, IL-12p70 and MCP-1 levels in serum and liver homogenates from mice transplanted with Ad-IL-18BP/IL-4-BNL.CL2 were lower and IL-4 and IL-10 levels were higher than control groups. Phosphorylation levels of NF-κB p65, AKT, p38 and JNK1/2 in liver homogenates were markedly suppressed by Ad-IL-18BP/IL-4.CONCLUSIONS:Ad-IL-18BP/IL-4 was effectively transfected into mouse BNL.CL2 cells. Intrasplenic transplantation of Ad-IL-18BP/IL-4-BNL.CL12 cells alleviated the severity of inflammation in ConA-induced experimental hepatitis and provides a useful basis for the targeted gene therapy of liver disease.

Salecan protected against concanavalin A-induced acute liver injury by modulating T cell immune responses and NMR-based metabolic profiles.

Protective Effects of Salecan Against Carbon Tetrachloride-Induced Acute Liver Injury in Mice

Ctggtgctgcc aaggctgt acaacctggtcctcagtgtagccca gagacattcccat gctgccaccgtcactggg aacgcgcagatcatg ccagagcctcgtggtacttctc gcaggacctcattttaa tctccaacatgcctctcttcatc gcatcaaaaacttg gccctgaagctttttgtcag gaatcgagcagaac agccttctctggacacctga gccaatatgaggaa gggtgcttgtttatggcttc

Salecan confers anti-inflammatory effects in liver injury via regulating gut microbiota and its metabolites

A Novel Soluble Beta-Glucan Salecan Protects Against Acute Alcohol-Induced Hepatotoxicity in Mice

Supplementation of the diet with Salecan attenuates the symptoms of colitis induced by dextran sulphate sodium in mice.

Celastrol pretreatment attenuates concanavalin A-induced hepatitis in mice by suppressing interleukin-6/STAT3-interleukin-17 signaling

The Protective Effect of Intrasplenic Transplantation of Ad-IL-18BP/IL-4 Gene-Modified Fetal Hepatocytes on ConA-induced Hepatitis in Mice.

Dietary salecan reverts partially the metabolic gene expressions and NMR-based metabolomic profiles from high-fat-diet-induced obese rats.

Protective Effects of N-Acetylcysteine in Concanavalin A-Induced Hepatitis in Mice

The Protective Effect of Glucan on Liver Injury Induced by Con A

Salecan ameliorates LPS-induced acute lung injury through regulating Keap1-Nrf2/HO-1 pathway in mice

S -Propargyl-cysteine prevents concanavalin A-induced immunological liver injury in mice.

Comprehensive Immune Cell Analysis of Human Menstrual-Blood-derived Stem Cells Therapy to Concanavalin A Hepatitis

Orally Administered Salecan Ameliorates Methotrexate-Induced Intestinal Mucositis in Mice

Pretreatment with a Low Dose of Concanavalin A Attenuated the Development of Concanavalin A-induced Hepatitis

Salvianolic acid A preconditioning confers protection against concanavalin A-induced liver injury through SIRT1-mediated repression of p66shc in mice.

Protective effect of galangin in Concanavalin A- induced hepatitis in mice

An experimental study on concanavalin A-induced acute hepatic injury in mice

Results of a 90-day safety assessment study in mice fed a glucan produced by Agrobacterium sp. ZX09.

The Protective Effect Of Resveratrol On Concanavalin-A-Induced Acute Hepatic Injury In Mice