Abstract:Broccoli seed extract (BSE) is rich in glucoraphanin (GRP), which may be transformed by intestinal microbes into sulforaphane (SFN), a compound with strong anti-inflammatory and antioxidant activities. Liver injury usually presents with inflammation and oxidative damage. Thus, dietary BSE supplementation may be an effective approach for alleviating liver injury. In this study, a mouse lipopolysaccharide (LPS)-induced acute liver injury model was used to evaluate the preventive effect of BSE and explore the relevant mechanisms. Compared with the LPS model group, the mice in the BSE group showed significantly lower activities of aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), and lactate dehydrogenase (LDH) and higher levels of catalase (CAT), superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activity. Meanwhile, BSE significantly reduced the levels of pro-inflammatory cytokines (including IL-6 and TNF-α) in the liver and increased the level of anti-inflammatory factor (IL-10), indicating that BSE had a good preventive effect on acute liver injury. Additionally, after BSE intervention, the diversity of intestinal microbiota in the mice was higher than that in the LPS model group. The relative abundance of Akkermansia and Lactobacillus increased, while the relative abundance of Xylanophilum decreased. A correlation analysis revealed that the activities of SOD, GSH-Px, CAT and levels of IL-10 were positively correlated with the relative abundance of Lactobacillus. Furthermore, sulforaphane (SFN) and (Sulforaphane-N-Acetyl-Cysteine) SFN-NAC were detected in the urine of the mice after BSE intervention. Both q-PCR and an immunohistochemical analysis showed that BSE significantly regulated the expression level of the NF-κB (IκB-α, NF-κB) and Nrf2 (Nrf2, p-Nrf2 and HO-1) signaling pathways in the liver. In conclusion, BSE was shown to reduce LPS-induced acute liver injury through the conversion of glucoraphanin into sulforaphane and the regulation of the gut microbiota composition. These results suggest that BSE could be a promising ingredient in functional foods.

Salecan confers anti-inflammatory effects in liver injury via regulating gut microbiota and its metabolites

Protective Effects of Salecan Against Carbon Tetrachloride-Induced Acute Liver Injury in Mice

Salecan protected against concanavalin A-induced acute liver injury by modulating T cell immune responses and NMR-based metabolic profiles.

Pharmacodynamic Study of Chitosan in Combination with Salvianolic Acid B in the Treatment of CC14‐induced Liver Fibrosis in Mice

Ctggtgctgcc aaggctgt acaacctggtcctcagtgtagccca gagacattcccat gctgccaccgtcactggg aacgcgcagatcatg ccagagcctcgtggtacttctc gcaggacctcattttaa tctccaacatgcctctcttcatc gcatcaaaaacttg gccctgaagctttttgtcag gaatcgagcagaac agccttctctggacacctga gccaatatgaggaa gggtgcttgtttatggcttc

Salecan ameliorates LPS-induced acute lung injury through regulating Keap1-Nrf2/HO-1 pathway in mice

A Novel Soluble Beta-Glucan Salecan Protects Against Acute Alcohol-Induced Hepatotoxicity in Mice

Supplementation of the diet with Salecan attenuates the symptoms of colitis induced by dextran sulphate sodium in mice.

Metabolomics Profiling in a Mouse Model Reveals Protective Effect of Sancao Granule on Con A-Induced Liver Injury.

Salecan Diet Increases Short Chain Fatty Acids and Enriches Beneficial Microbiota in the Mouse Cecum.

Dietary salecan reverts partially the metabolic gene expressions and NMR-based metabolomic profiles from high-fat-diet-induced obese rats.

Bifidobacterium adolescentis CGMCC 15058 alleviates liver injury, enhances the intestinal barrier and modifies the gut microbiota in d -galactosamine-treated rats

Hepatoprotective Effect of San-Cao Granule on Con A-Induced Liver Injury in Mice and Mechanisms of Action Exploration.

Combining fecal microbiome and metabolomics to reveal the disturbance of gut microbiota in liver injury and the therapeutic mechanism of shaoyao gancao decoction

Protective Effect of Lactiplantibacillus plantarum 1201 Combined with Galactooligosaccharide on Carbon Tetrachloride-Induced Acute Liver Injury in Mice

Chongcao-Shencha Attenuates Liver and Kidney Injury Through Attenuating Oxidative Stress and Inflammatory Response in D-Galactose-Treated Mice

A Novel Soluble Beta-1,3-D-Glucan Salecan Reduces Adiposity And Improves Glucose Tolerance In High-Fat Diet-Fed Mice

The Protective Effect of Broccoli Seed Extract against Lipopolysaccharide-Induced Acute Liver Injury via Gut Microbiota Modulation and Sulforaphane Production in Mice

Salecan Enhances the Activities of Β-1,3-glucanase and Decreases the Biomass of Soil-Borne Fungi.

Sini san regulates intestinal flora and short-chain fatty acids to ameliorate hepatocyte apoptosis and relieve CCl4-induced liver fibrosis in mice

San-Cao Granule (三草颗粒) Ameliorates Hepatic Fibrosis through High Mobility Group Box-1 Protein/Smad Signaling Pathway