Impact of CLIA 88 on the clinical microbiology laboratory.

K. Chapin,E. Baron

DOI: https://doi.org/10.1016/0732-8893(95)00152-2

IF: 2.983

1995-09-01

Diagnostic Microbiology and Infectious Disease

Abstract:

What problem does this paper attempt to address?

Molecular Characterization and Pathogenicity of a Novel Monopartite Geminivirus Infecting Tobacco in China

Yuan Chen,Shiping Guo,Lianqiang Jiang,Fangfang Yan,Kaiqiang Hao,Zhiping Wang,Mengnan An,Zihao Xia,Fangfang Li,Xueping Zhou,Yuanhua Wu

DOI: https://doi.org/10.1016/j.virol.2024.110061

IF: 3.513

2024-01-01

Virology

Abstract:The occurrence of geminiviruses causes significant economic losses in many economically important crops. In this study, a novel geminivirus isolated from tobacco in Sichuan province of China, named tomato leaf curl Chuxiong virus (TLCCxV), was characterized by small RNA-based deep sequencing. The full-length of TLCCxV genome was determined to be 2744 nucleotides (nt) encoding six open reading frames. Phylogenetic and genome-wide pairwise identity analysis revealed that TLCCxV shared less than 91% identities with reported geminiviruses. A TLCCxV infectious clone was constructed and successfully infected Nicotiana benthamiana, N. tabacum, N. glutinosa, Solanum lycopersicum and Petunia hybrida plants. Furthermore, expression of the V2, C1 and C4 proteins through a potato virus X vector caused severe chlorosis or necrosis symptom in N. benthamiana. Taken together, we identified a new geminivirus in tobacco plants, and found that V2, C1 and C4 contribute to symptom development.
Acid-base indicators in N,N-dimethylformamide: chromatic parameters of transition ranges.

J. Barbosa,C. M. Bosch

DOI: https://doi.org/10.1016/0039-9140(91)80109-D

1991-11-01

Abstract:
Characterization Of A Novel Polerovirus Infecting Maize In China

Sha Chen,Guangzhuang Jiang,Jianxiang Wu,Yong Liu,Yajuan Qian,Xueping Zhou

DOI: https://doi.org/10.3390/v8050120

2016-01-01

Abstract:A novel virus, tentatively named Maize Yellow Mosaic Virus (MaYMV), was identified from the field-grown maize plants showing yellow mosaic symptoms on the leaves collected from the Yunnan Province of China by the deep sequencing of small RNAs. The complete 5642 nucleotide (nt)-long genome of the MaYMV shared the highest nucleotide sequence identity (73%) to Maize Yellow Dwarf Virus-RMV. Sequence comparisons and phylogenetic analyses suggested that MaYMV represents a new member of the genus Polerovirus in the family Luteoviridae. Furthermore, the P0 protein encoded by MaYMV was demonstrated to inhibit both local and systemic RNA silencing by co-infiltration assays using transgenic Nicotiana benthamiana line 16c carrying the GFP reporter gene, which further supported the identification of a new polerovirus. The biologically-active cDNA clone of MaYMV was generated by inserting the full-length cDNA of MaYMV into the binary vector pCB301. RT-PCR and Northern blot analyses showed that this clone was systemically infectious upon agro-inoculation into N. benthamiana. Subsequently, 13 different isolates of MaYMV from field-grown maize plants in different geographical locations of Yunnan and Guizhou provinces of China were sequenced. Analyses of their molecular variation indicate that the 3 half of P3-P5 read-through protein coding region was the most variable, whereas the coat protein- (CP-) and movement protein- (MP-)coding regions were the most conserved.
Action of topical thyroid hormone analogue, triiodothyroacetic acid in reversing glucocorticoid-induced skin atrophy in humans.

Parviz Yazdanparast,B. Carlsson,A. Oikarinen,J. Risteli,T. Lavin,J. Faergemann

DOI: https://doi.org/10.1089/THY.2006.16.1157

IF: 6.506

2006-11-24

Thyroid

Abstract:The present study concerns the effect of topical treatment with a cream formulation of triiodothyroacetic acid (TRIAC) in comparison with a placebo preparation in producing a reversal of skin atrophy induced by long-term employment of topical glucocorticoid therapy in humans. A total of 39 patients with clinically verified skin atrophy due to long-term use of topical potent glucocorticoids were randomized. The changes in skin thickness, elastic fibers, and hyaluronic acid were evaluated by means of sonography and histology. After 8 weeks' treatment, the skin thickness measured by sonography increased by 16% in the epidermis, 8% in the dermis, and epidermis + dermis in the placebo group. In the TRIAC 0.1% group, the corresponding values were 24% ( p=0.063) in the epidermis, 28% ( p=0.042) in the dermis, and 25% ( p=0.039) in the epidermis + dermis. After 8 weeks, in the placebo group, the skin thickness measured by biopsy increased by 5% in the epidermis, epidermis + dermis, and 6% in the dermis. In the TRIAC 0.1% group, the corresponding values were 31% ( p=0.041) in the epidermis, 46% ( p=0.041) in the dermis and 44% ( p=0.043) in the epidermis + dermis. After 8 weeks, the elastic fibers of moderately irregular and thickened fibers increased by 56% in the placebo group and 100% ( p=0.043) in the TRIAC 0.1 group. This study indicates that topical treatment with TRIAC appears to reverse glucocorticoid-induced skin atrophy under the narrow conditions tested.
First Report of Pepper Veinal Mottle Virus Infecting Pepper in Mainland China

S. B. Zhang,Zijin Zhao,Limin Zheng,D. Y. Zhang,Ye Liu,Jun Liu,Jianxiu Du,Jing Peng,Fei Yan,F. Li,Yan Xie,Zhiyuan Cheng

DOI: https://doi.org/10.1094/pdis-08-15-0870-pdn

IF: 4.5

2016-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 100, No. 5First Report of Pepper veinal mottle virus Infecting Pepper in Mainland China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Pepper veinal mottle virus Infecting Pepper in Mainland ChinaS. B. Zhang, Z. B. Zhao, L. M. Zheng, D. Y. Zhang, Y. Liu, J. Liu, J. Du, J. Peng, F. Yan, F. Li, Y. Xie, and Z. B. ChengS. B. ZhangSearch for more papers by this author, Z. B. ZhaoSearch for more papers by this author, L. M. ZhengSearch for more papers by this author, D. Y. ZhangSearch for more papers by this author, Y. LiuSearch for more papers by this author, J. LiuSearch for more papers by this author, J. DuSearch for more papers by this author, J. PengSearch for more papers by this author, F. YanSearch for more papers by this author, F. LiSearch for more papers by this author, Y. XieSearch for more papers by this author, and Z. B. ChengSearch for more papers by this authorAffiliationsAuthors and Affiliations S. B. Zhang Z. B. Zhao L. M. Zheng D. Y. Zhang Y. Liu J. Liu J. Du J. Peng , Key Laboratory of Pest Management of Horticultural Crop of Hunan Province, Hunan Plant Protection Institute, Hunan Academy of Agricultural Science, Changsha 410125, China F. Yan , Virology and Biotechnology Institute, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China F. Li , Key Laboratory of Agricultural Biodiversity for Pest Management of China Education Ministry, Yunnan Agricultural University, Kunming 650201, China Y. Xie , Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China Z. B. Cheng , Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Nanjing 201014, China. Published Online:29 Feb 2016https://doi.org/10.1094/PDIS-08-15-0870-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Pepper veinal mottle virus (PVMV), a virus species in the genus Potyvirus in the family Potyviridae, has been reported to infect several crops of Solanaceae in several countries and regions of Africa (Huguenot et al. 1996) and East Asia (Taiwan and South Korea) (Ceng et al. 2009; Ha et al. 2008). During a survey of pepper diseases in June 2013, about 15% of red pepper (Capsicum annuum) plants with viral-like symptoms of stunting, veinal chlorosis, and leaf curl and mottle were observed in Changsha, Hunan Province, China. Three diseased plants were collected and tested by high throughput small RNA sequencing (Ho et al. 2014) for pathogen identification. Total RNA was extracted using Trizol reagent (Sangon Biotech, Shanghai, China) from pooled leaf samples of the three plants. Small RNA libraries were constructed using the “Small RNA v1.5 Sample Prep” kit (Illumina, San Diego, CA) and sequenced by high throughput sequencing using a Solexa sequencer (Illumina). Raw data of approximate 8 million reads were analyzed using the Illumina GA Pipeline v1.3. High quality small RNA reads (18 to 30 nt) were assembled to contigs using the software Velvet 1.0.5. A BLASTn search of the resultant contigs to the viral genomes of the GenBank database identified about 300 contigs with high nucleotide sequence homologies (>96%) to seven viruses, among which PVMV was matched by 16 contigs with high identities (>98%). To confirm the presence of PVMV, the samples were tested by reverse transcription (RT)-PCR using a primer pair PMF (5′-AATTAAGCCATTGATTGACCA-3′) and PMR (5′-AGCGCCAATTATGAAACCGC-3′), and a ∼744-bp fragment of partial coat protein gene of PVMV was amplified from three symptomatic samples, but not from a healthy pepper sample. The DNA fragment from a selected sample was sequenced and deposited under GenBank Accession No. KT285204. This fragment shared 99% nucleotide identity with a PVMV isolate from South Korea (DQ645484). Northern blot using a digoxigenin-labeled PCR fragment amplified by primers PMF and PMR also confirmed the presence of PVMV from an infected plant. To our best knowledge, this is the first report of PVMV naturally infecting pepper in mainland China.References:Ceng, Y. H., et al. 2009. Plant Dis. 93:107. Google ScholarHa, J. H., et al. 2008. Arch. Virol. 153:2315. https://doi.org/10.1007/s00705-008-0245-0 Crossref, ISI, Google ScholarHo, T., et al. 2014. Virology 471-473:54. https://doi.org/10.1016/j.virol.2014.09.019 Crossref, ISI, Google ScholarHuguenot, C., et al. 1996. J. Phytopathol. 144:29. https://doi.org/10.1111/j.1439-0434.1996.tb01484.x Crossref, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 100, No. 5 May 2016SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 15 Apr 2016Published: 29 Feb 2016First Look: 5 Nov 2015Accepted: 19 Oct 2015 Pages: 1025-1025 Information© 2016 The American Phytopathological SocietyCited byPepper veinal mottle virusCABI Compendium, Vol. CABI CompendiumIdentification of a novel pepper-infecting monopartite begomovirus in China20 March 2021 | Archives of Virology, Vol. 166, No. 6Capsicum annuum and Capsicum frutescens (Bell pepper, Chilli, Pepper, Sweet pepper)6 June 2020
First Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium Candidum in China

Zhongyang Sun,Y. H. Zhang,Qian Xu,Zhong Chen,Li Xie,Bizeng Mao

DOI: https://doi.org/10.1094/pdis-07-18-1165-pdn

IF: 4.5

2019-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 103, No. 5First Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium candidum in China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium candidum in ChinaZ. Y. Sun, Y. H. Zhang, Q. Q. Xu, Z. X. Chen, L. Xie, and B. Z. MaoZ. Y. Sunhttp://orcid.org/0000-0003-4453-0284Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this author, Y. H. ZhangInstitute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this author, Q. Q. XuInstitute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this author, Z. X. ChenInstitute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this author, L. XieAnalysis Center of Agrobiology and Environmental Science, Zhejiang University, Hangzhou 310058, ChinaSearch for more papers by this author, and B. Z. Mao†Corresponding author: B. Z. Mao; E-mail: E-mail Address: [email protected]Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this authorAffiliationsAuthors and Affiliations Z. Y. Sun1 Y. H. Zhang1 Q. Q. Xu1 Z. X. Chen1 L. Xie2 B. Z. Mao1 † 1Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and 2Analysis Center of Agrobiology and Environmental Science, Zhejiang University, Hangzhou 310058, China Published Online:26 Feb 2019https://doi.org/10.1094/PDIS-07-18-1165-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Dendrobium candidum is one of the traditional medicinal plants of China and has been recorded in the Chinese Pharmacopoeia (2005 edition) as one of the original materials of “Shi Hu” (Li et al. 2008). Its stems are made as medicine for antipyretic, eyes-benefiting, antitumor, antiaging, and tonic purposes. In May 2018, chlorotic blotches, mosaic, and mottle symptoms were observed on 3-year-old seedlings in the greenhouse in Menghai City, Yunnan Province, China. After negative staining of samples with phosphotungstic acid, flexuous filamentous virus particles of 600 to 900 nm in length were observed using a transmission electron microscope (TEM). Bundles of flexuous filamentous particles and cylindrical inclusion bodies typical of potyviruses were observed in the cells of D. candidum under TEM after ultrathin sectioning. Leaf samples were collected from 18 symptomatic plants and tested by double antibody sandwich ELISA (Takara) with antisera against sweet potato feathery mottle virus (SPFMV), zucchini yellow mosaic virus, turnip mosaic virus, and potato virus Y. Eight samples reacted with the SPFMV antiserum, but none of the 18 samples reacted with the other antisera. Total nucleic acids were extracted from six symptomatic leaf samples using Fruit-mate for RNA Purification (Takara) and TRIzol, and they were then tested with reverse transcription polymerase chain reaction (PCR) using a pair of specific primers, SPFMV-F and SPFMV-R (Kwak et al. 2014). A single band of 356 bp was observed when the PCR products were analyzed on a 1% agarose gel. The PCR product was purified using a DNA Gel Extraction Kit (Tsingke, China), cloned in pGEM-T Easy Vector (Promega), and sequenced in both directions. A consensus sequence was obtained from six clones and submitted to GenBank (MH508094). This isolate shared 98 to 99% nucleotide identity with corresponding SPFMV sequences deposited in GenBank and showed the highest nucleotide sequence identity (99%) with the Korean isolate of SPFMV from sweet potato (KP115608). This is the first report of SPFMV naturally infecting D. candidum in China; therefore, effective management strategies should be adopted to prevent introduction of this virus in D. candidum growing regions.References:Kwak, H.-R., et al. 2014. Plant Pathol. J. 30:416. https://doi.org/10.5423/PPJ.OA.04.2014.0029 Crossref, ISI, Google ScholarLi, Y., et al. 2008. Chem. Pharm. Bull. (Tokyo) 56:1477. https://doi.org/10.1248/cpb.56.1477 Crossref, ISI, Google ScholarZ. Y. Sun and Y. H. Zhang contributed equally to this article.Funding: This research was supported by the key research and development projects of Zhejiang Province in 2018 (no. 2018C02034) and Zhejiang province agricultural Chinese medicine new variety breeding major science and technology special project (no. 2016C02058-3).DetailsFiguresLiterature CitedRelated Vol. 103, No. 5 May 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionTomato leaves infected with Tomato chlorotic dwarf viroid (Olmedo-Velarde, Roy, Belanger, Watanabe, Hamasaki, Mavrodieva, Nakhla, and Melzer). Photo credit: M. J. Melzer. Spinach plants with downy mildew symptoms caused by Peronospora effusa (Kandel, Mou, Shishkoff, Shi, Subbarao, and Klosterman). Photo credit: S. L. Kandel. Metrics Article History Issue Date: 8 May 2019Published: 26 Feb 2019First Look: 15 Nov 2018Accepted: 12 Nov 2018 Pages: 1047-1047 Information© 2019 The American Phytopathological SocietyFundingkey research and development projects of Zhejiang Province in 2018Grant/Award Number: 2018C02034Zhejiang province agricultural Chinese medicine new variety breeding major science and technology special projectGrant/Award Number: 2016C02058-3Cited byDevelopment of a dual RT-RPA detection for Sweet potato feathery mottle virus and Sweet potato chlorotic stunt virusMolecular and Cellular Probes, Vol. 65Sweet potato feathery mottle virus (internal cork disease of sweet potato)CABI Compendium, Vol. CABI CompendiumDissipation, occurrence, and risk assessment of 12 pesticides in Dendrobium officinale Kimura et MigoEcotoxicology and Environmental Safety, Vol. 222A rapid sap‐direct reverse transcription‐polymerase chain reaction method for detection of dendrobium viroid in Dendrobium plants19 May 2021 | Letters in Applied Microbiology, Vol. 73, No. 1Dendrobium viroid, a new monocot-infecting apscaviroidVirus Research, Vol. 282
Genomic Analysis of a Novel Torradovirus "Rehmannia Torradovirus Virus": Two Distinct Variants Infecting Rehmannia glutinosa

Yanhong Qin,Shuhao Lu,Yi Wen,Shaojian Li,Suxia Gao,Desheng Zhang,Xuemeng Li,Jin Yang,Li Gu,Mingjie Li,Fei Wang,Chuantao Lu

DOI: https://doi.org/10.3390/microorganisms12081643

IF: 4.5

2024-08-11

Microorganisms

Abstract:Rehmannia glutinosa, a crucial medicinal plant native to China, is extensively cultivated across East Asia. We used high-throughput sequencing to identify viruses infecting R. glutinosa with mosaic, leaf yellowing, and necrotic symptoms. A novel Torradovirus, which we tentatively named "Rehmannia torradovirus virus" (ReTV), was identified. The complete sequences were obtained through reverse-transcription polymerase chain reaction (RT-PCR), 5' and 3' rapid amplification of cDNA ends, and Sanger sequencing. The amino acid sequence alignment between the ReTV-52 isolate and known Torradovirus species in the Pro-Pol and coat protein regions were 51.3-73.3% and 37.1-68.1%, respectively. Meanwhile, the amino acid sequence alignment between the ReTV-8 isolate and known Torradovirus species in the Pro-Pol and coat protein regions were 52.7-72.8% and 36.8-67.5%, respectively. The sequence analysis classified ten ReTV strains into two variants. The ReTV-52 genome has two RNA segments of 6939 and 4569 nucleotides, while that of ReTV-8 consists of two RNA segments containing 6889 and 4662 nucleotides. Sequence comparisons and phylogenetic analysis showed ReTV strains clustered within the Torradovirus, exhibiting the closet relation to the squash chlorotic leaf spot virus. The RT-PCR results showed a 100% ReTV detection rate in all 60 R. glutinosa samples. Therefore, ReTV should be classified as a novel Torradovirus species. ReTV is potentially dangerous to R. glutinosa, and necessitating monitoring this virus in the field.
First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China

Fangqi Chen,Le Wang,Ruifang Jia,Yuanyuan Zhang,Juan Sun,Zhengqiang Chen,Kejian Lin

DOI: https://doi.org/10.1094/PDIS-06-24-1212-PDN

2024-09-11

Abstract:Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.
First report of pepper chlorosis-associated virus infecting tobacco (Nicotiana tabacum) plants in Sichuan Province in China

Fang Wang,Junyan Zhu,Yonghui Zhang,Ying Chen,Dankan Yan,Zhaoting Zhang,Ke Wang,Kelei Han,Chao Ma,Benguo Zhou,Chuan Tao Xu

DOI: https://doi.org/10.1094/PDIS-01-24-0002-PDN

2024-05-12

Abstract:Tobacco (Nicotiana tabacum) is an economically important crop in China, and more than 30 viruses have been reported to infect tobacco (Yin et al. 2022). In July 2022, we observed interveinal necrosis on tobacco leaves in fields in Sichuan Province (N 27.9172, E 105.6662) (Fig. 1). Total RNA was isolated from multiple leaves of one plant using an RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Extraction Kit (TIANGEN, Beijing, China). Total RNAs were pooled, and a TruSeq Stranded Total RNA with RiboZero Gold Kit (Illumina, San Diego, CA, USA) was used to eliminate ribosomal RNA. An RNA-Seq library was constructed using VAHTS Universal V6 RNA-seq Library Prep (Nanjing Vazyme, China). High-throughput sequencing was performed on the Illumina DNBseq platform (BGI-ShenZhen, China), which yielded 20,102,087 reads with an average length of 150 nt (total size >6 Gb). Unaligned reads were assembled de novo using SPAdes (Bankevich et al. 2012). Contigs with length ≥200 nt were subjected to local BLASTn and BLASTx analyses against the GenBank nt and nr databases, respectively (Wang et al. 2022). A total of 23 contigs were identified through BLASTx (e-value cut-off = 10 -3), ranging from 631 to 1555 bp long, with 82% to 96% coverage to partial genomic sequences of pepper chlorosis-associated virus (PepCaV-Higashitsuno_2021; Accessions: LC719619 to LC719621) and one contig (6459 bp) with 99% similarity to tobacco mosaic virus (Accession: OP525281) isolate DSMZ PV-0109 from Germany. The complete genome sequence of PepCaV was obtained using primers based on the assembled contigs. The 5'- and 3'-terminal regions of the RNA genome were obtained by 5'- and 3'-rapid amplification of cDNA ends. These amplicons were cloned using the pEASY-Blunt Zero Cloning Kit (TRANSGEN, Nangjing, China) and sequenced by Sanger sequencing. Complete genome sequences of tripartite PepCaV from tobacco samples were 7697, 1808, and 1557 nucleotides long (Accession: OR451987 to OR451989) and showed genome organization typical of the genus Ophiovirus in the family Aspiviridae. The complete sequences of RNA1, RNA2 and RNA3 genome segments shared 92.36%, 90.43%, and 95.24%, nucleotide sequence identities, respectively, with the isolate PepCaV-Higashitsuno_2021 pepper isolate (Accession: LC719619 to LC719621) (Shimomoto et al. 2023), but PepCaV has not been reported to infect N. tabacum. In June 2023, 10 plants collected from each place of Macheng (N 27.9094, E 105.6740), Xiangyang (N 28.0936, E 105.6249) and Moni (N 27.8899, E 105.5936) showing interveinal necrosis symptoms were tested using RT-PCR using PepCaV-MP610-F (5'-TGTTCTCTGCTATGCGGTTG -3') and PepCaV-MP610-R (5'-AGCAATCTCGCACCTGAAGT-3') to product 610bp amplicon. Twenty-five tobacco plants were positive for PepCaV. Single sequence from each location was submitted to GenBank (Accession: PP728631 to PP728633). Sap extracts from the original field leaf samples collected from Sichuan Province were used to mechanically inoculate tobacco plants (10 plants) at the four-leaf stage. After 7 days, leaf samples were tested using RT-PCR assay specific to PepCaV and TMV while samples were positive only for TMV but failed to transmit PepCaV by mechanical inoculation. According to previous literature, ophioviruses may be transmitted though soilborne fungus (Jeong et al. 2014). Further research is needed to understand the transmission, epidemiology, and pathological properties of the PepCaV. To our knowledge, this is the first report documenting natural PepCaV infection of tobacco plants in China, providing a scientific basis for PepCaV infection control in tobacco plantations.
Neuroradiology case of the day. Sagittal sinus thrombosis with hemorrhagic venous infarct.

J. E. Dix,W. F. Marx,W. Cail

DOI: https://doi.org/10.2214/AJR.167.1.8659396

1996-07-01

Abstract:
Decompression "Iridopathy" Following Diode Laser Cycloablation.

T. A. Williams,F. Sii,M. Chiang,P. Shah

DOI: https://doi.org/10.3928/15428877-20100216-13

Abstract:
President-Elect's Message: The Support of Dental Research

H. Fullmer

DOI: https://doi.org/10.1177/002203457605500408011

1976-04-01

Abstract:
Genetic Variation and Population Structure of Cucumber Green Mottle Mosaic Virus.

Li-xia Rao,Yushuang Guo,Li-li Zhang,Xue-ping Zhou,Jian Hong,Jian-xiang Wu

DOI: https://doi.org/10.1007/s00705-016-3207-y

IF: 2.685

2017-01-01

Archives of Virology

Abstract:Cucumber green mottle mosaic virus (CGMMV) is a single-stranded, positive sense RNA virus infecting cucurbitaceous plants. In recent years, CGMMV has become an important pathogen of cucurbitaceous crops including watermelon, pumpkin, cucumber and bottle gourd in China, causing serious losses to their production. In this study, we surveyed CGMMV infection in various cucurbitaceous crops grown in Zhejiang Province and in several seed lots purchased from local stores with the dot enzyme-linked immunosorbent assay (dot-ELISA), using a CGMMV specific monoclonal antibody. Seven CGMMV isolates obtained from watermelon, grafted watermelon or oriental melon samples were cloned and sequenced. Identity analysis showed that the nucleotide identities of the seven complete genome sequences ranged from 99.2 to 100%. Phylogenetic analysis of seven CGMMV isolates as well as 24 other CGMMV isolates from the GenBank database showed that all CGMMV isolates could be grouped into two distinct monophyletic clades according to geographic distribution, i.e. Asian isolates for subtype I and European isolates for subtype II, indicating that population diversification of CGMMV isolates may be affected by geographical distribution. Site variation rate analysis of CGMMV found that the overall variation rate was below 8% and mainly ranged from 2 to 5%, indicating that the CGMMV genomic sequence was conservative. Base substitution type analysis of CGMMV showed a mutational bias, with more transitions (A↔G and C↔T) than transversions (A↔C, A↔T, G↔C and G↔T). Most of the variation occurring in the CGMMV genome resulted in non-synonymous substitutions, and the variation rate of some sites was higher than 30% because of this mutational bias. Selection constraint analysis of CGMMV ORFs showed strong negative selection acting on the replication-associated protein, similar to what occurs for other plant RNA viruses. Finally, potential recombination analysis identified isolate Ec as a recombinant with a low degree of confidence.
First Report of Cucumber Green Mottle Mosaic Virus Infecting Zucchini (Cucurbita pepo) and Wax Gourd (Benincasa hispida) in China

Xiaohui Sun,Bin Wu,Shanshan Jiang,Hao Hong,Zhimei Xin,Mei Zhang,Shengji Wang,Xiaoping Zhu,Xiangqi Xin

DOI: https://doi.org/10.1094/PDIS-05-23-0881-PDN

2023-07-19

Abstract:Cucumber green mottle mosaic virus (CGMMV) was first discovered in China in 2003 and caused an epidemic in 2005. In China, the virus has been reported in gourd crops including watermelons, cucumbers, melons, etc (Sui et al. 2019). In Shandong Province, China from September 2014 to 2017, approximately 30% of zucchini (Cucurbita pepo) and wax gourd (Benincasa hispida) plants in commercial cucurbit fields, the two most important cash crops, exhibited chlorosis, mosaic, and mottling symptoms suspected to be caused by a tobamovirus. To identify the causative pathogens, ten zucchini and 15 wax gourd samples were collected from the commercial cucurbit fields. Total RNA was extracted and all samples were tested using reverse transcription PCR (RT-PCR) with TobamodF/TobamodR and TobamodF2/TobamodR2 (Li et al. 2018a). Five common Cucurbitaceae viruses were also tested: cucumber mosaic virus, papaya ringspot virus, squash mosaic virus, watermelon mosaic virus, and zucchini yellow mosaic virus (Ali et al. 2012). All samples generated positive results using tobamovirus generic primers but were negative for the five common Cucurbitaceae viruses. Amplification products (880 bp) from all samples were inserted into pMD19-T and recombinant clones were selected for Sanger sequencing. The results showed that zucchini green mottle mosaic virus, CGMMV, and tobacco mosaic virus (TMV) were detected in zucchini samples. CGMMV and TMV were detected in the wax gourd samples. To confirm the presence of these viruses, RT-PCR was performed using specific primer pairs, including CGMMV-cpf/CGMMV-cpr (Chen et al. 2006), ZG-F/ZG-R (Li et al. 2018b), and TMV-CP-F/TMV-CP-R (Srivastava et al. 2015). CGMMV was detected in all samples, with four zucchini and nine wax gourds only containing CGMMV. Zucchini (n=4; CGZ1-CGZ4) and wax gourd (n=4; CGWX1-CGWX4) isolates were cloned into pMD19-T and sequenced bidirectionally. The BLASTn results confirmed the presence of CGMMV, and the sequencing results were processed using DNAMAN Version (Lynnon Biosoft, San Ramon, CA, USA) and submitted to the GenBank database (https://www.ncbi.nlm.nih.gov/). A phylogenetic tree based on the CGMMV coat protein (CP) was constructed using CGZ1-CGZ4 (OP779762-OP779765), CGWX1-CGWX4 (OP779766-OP779769), and representative CGMMV sequences from GenBank. Sequence analysis of the CP demonstrated that CGMMV-zucchini and -wax gourd isolates belonged to an independent branch of the Chinese muskmelon AH-FT197 isolate (KU175639) and had 100% identity with the AH-FT197 isolate. To confirm their infectivity, leaf sap extract of CGZ4 and CGWX4 in phosphate buffer (0.1 M, pH 7.0) was mechanically inoculated on leaves of virus-free zucchini seedlings (Cucurbita pepo cv. Zaoqingyidai, 4-leaf-stage, n = 10) or virus-free wax gourd seedlings (Benincasa hispida cv. Tiezhu 2, n = 10). Ten days after inoculation, all plants exhibited symptoms (systemic chlorosis, mosaic, and mottling) similar to those of diseased plants in the field. Control seedlings inoculated with phosphate buffer remained symptomless. RT-PCR analysis using the CGMMV-cpf/CGMMV-cpr primer confirmed that all ten zucchini or wax gourd seedlings were infected with CGMMV, and all the control plants were free from CGMMV. To the best of our knowledge, this is the first report on zucchini and wax gourd as natural hosts for CGMMV in China. CGMMV is a highly contagious seed-borne virus and further attention should be paid to its spread in cucurbit crops.
[Effects of human dendritic cells derived from CD34(+) cells on the biologic characteristic of bone marrow-derived mesenchymal stem cells].

Yong-feng Su,Siwei Huo,Xiao-Xia Jiang,Yuanlin Liu,Ying Wu,N. Mao,Yi Zhang

2009-08-01

Abstract:This study was purposed to clarify whether biology function of mesenchymal stem cells (MSCs) is changed by suppressing the development of dendritic cells (DC) derived from hematopoietic stem cells (HSCs). MSCs were cocultured with dendritic cells derived from CD34 positive hematopoietic stem cells (HSCs), and then the expression of cytokines and phenotypes of DCs/MSCs were detected by RT-PCR and flow cytometry respectively. Induced experiments were used to analyze the differentiation ability of MSCs. The results showed that DCs/MSCs were negative for the CD14, CD34, CD45, CD31, CD86, but positive for HLA-ABC, CD29, CD73, though the percentage decreased as MSCs vs DCs/MSCs (93.1% vs 13.44%, 98.3% vs 78.8%, 95.3% vs 75.9%). In addition, the expression of cytokines such as M-CSF, TGF-beta increased in DCs/MSCs. After differentiation induction, DCs/MSCs were deprived of the potential to differentiate into adipocytes, but maintained osteogenesis characteristics. It is concluded that the basic characteristics of MSCs are altered after coculture with DCs, and DCs/MSCs result in lower expression of mesenchymal phenotypes and decrease differentiation ability, but increase the expression of cytokines related to hematopoiesis and immunity.
First Report of Watermelon mosaic virus causing a Mosaic Disease on Cucumis metuliferus in China

Qiang Gao,Hai-Long Ren,Wanyu Xiao,Yan Zhang,Bo Zhou,Donglin Xu

DOI: https://doi.org/10.1094/PDIS-12-20-2744-PDN

2021-02-05

Abstract:Cucumis metuliferus, also called horned cucumber or jelly melon, is considered as a wild species in the Cucumis genus and a potential material for nematodes- or viruses-resistant breeding (Provvidenti, et al. 1977; Sigüenza et al. 2005; Chen et al. 2020). This species, originating from Africa, has been cultivated as a fruit in China in recent years. In July 2020, a mosaic disease was observed on C. metuliferus growing in five fields (approximately 0.7 hectare) in Urumqi, Xijiang, China, where more than 85~100% of the field plants exhibited moderate to severe viral disease-like leaf mosaic and/or deformation symptoms. Delayed flowering and small and/or deformed fruits on the affected plants could result in yield loss of about 50%. To identify the causal pathogen, the symptomatic leaf samples were collected from the five fields (five plants/points for each field) and their total RNAs were extracted using a commercial RNA extraction kit. The universal potyviral primers (Ha et al. 2008) and specific primers for a number of frequently-occurring, cucurbit crop-infecting viruses including Papaya ringspot virus (PRSV) (Lin et al. 2013), Cucumber mosaic virus (CMV) and Watermelon mosaic virus (WMV) were designed and used for detection by RT-PCR. The result showed that only the WMV primers (forward: 5'-AAGTGTGACCAAGCTTGGACTGCA-3' and reverse: 5'-CTCACCCATTGTGCCAAAGAACGT-3') could amplify the corresponding target fragment from the total RNA templates, and direct sequencing of the RT-PCR products and GenBank BLAST confirmed the presence of WMV (genus Potyvirus) in the collected C. metuliferus samples. To complete Koch's postulates, the infected C. metuliferus leaves were ground in the sodium phosphate buffer (0.01 M, pH 7.0) and the sap was mechanically inoculated onto 30 four-leaf-stage C. metuliferus seedlings (two leaves for each seedling were inoculated) kept in an insect-proof, temperature-controlled greenhouse at 25~28℃. Twenty-five of the inoculated plants were observed to have apparent leaf mosaic similar to the field symptoms two weeks after inoculation, and positive result was obtained in RT-PCR detection for the symptomatic leaves of inoculated plants using the WMV primers aforementioned, confirming the virus as the pathogen of C. metuliferus in Urumqi. To our knowledge, this is the first report of WMV naturally infecting C. metuliferus in China. We obtained the full-length sequence of the WMV Urumqi isolation (WMV-Urumqi) by sequencing the RT-PCR amplicons from seven pairs of primers spanning the viral genome and the 5'RACE and 3'RACE products. The complete sequence of WMV-Urumqi (GenBank accession no. MW345911) is 10046 nucleotides (nt) long and contains an open reading frame that encodes a polyprotein of 3220 amino acids (aa). WMV-Urumqi shares the highest nt identity (95.9%) and aa identity (98.0%) with the Cucurbita pepo-infecting isolation (KX664483) from Shanxi province, China. Our findings provide a better understanding of the host range and genetic diversity of WMV, and a useful reference for virus-resistant breeding involving C. metuliferus.
First Report of Chilli veinal mottle virus Infecting Tomato (Solanum lycopersicum) in China

F-F Zhao,D-H Xi,J Liu,X-G Deng,H-H Lin

DOI: https://doi.org/10.1094/PDIS-11-13-1188-PDN

Abstract:Chilli veinal mottle virus (ChiVMV), a potyvirus, is widespread over the world. In China, it was first reported in chili pepper (Capsicum annuum) in Hainan Province (south China) in 2006 (2). Subsequently, it was reported in tobacco (Nicotiana tabacum) in Yunnan Province (southwest China) in 2011 (1). Sichuan Province is one of the largest vegetable producing areas of China. In May 2012, tomatoes with leaves displaying virus-infected symptoms like mottling, mosaic, narrowing, or curling were observed in several fields of Chengdu, eastern Sichuan Province, southwest China. Of the 20 fields we investigated, four fields with 90% tomato plants were infected. During 2012 and 2013, six samples were collected from symptomatic tomato leaves based on different symptoms and locations. All six samples were assayed by western blotting using polyclonal antisera (Cucumber mosaic virus [CMV], Tobacco mosaic virus [TMV]) obtained from Agdia (Elkhart) and one antiserum to ChiVMV obtained from Yunnan Academy of Agricultural Science (China). Two samples from Pengzhou and one sample from Shuangliu exhibiting mosaic leaves were positive for TMV, one sample from Pixian exhibiting narrowing leaves was positive for CMV, and the other two samples from Shuangliu exhibiting mottle and leaf distortion were positive for ChiVMV. Total RNAs was extracted from all six samples and healthy tomato leaves using Trizol reagent (Invitrogen), First-strand cDNA synthesis primed with oligo(dT) by SuperScript III Reverse Transcriptase (Invitrogen). RT-PCR was performed using primer pairs ChiVMV-CP F (5'-GCAGGAGAGAGTGTTGATGCTG-3') and ChiVMV-CP R (5'-(T)16AACGCCAACTATTG-3'), which were designed to direct the amplification of the entire capsid protein (CP) gene and 3' untranslated region (3'-UTR) of ChiVMV (GenBank Accession No. KC711055). The expected 1,166-bp DNA fragment was amplified from the two tomato samples from Shuangliu that were positive for ChiVMV in the western blot tests, but not from the others. The obtained fragments were purified and cloned into the PMD18-T vector (TaKaRa) and sequenced. The sequencing results showed that the two ChiVMV isolates from tomato in Shuangliu were identical (KF738253). Nucleotide BLAST analysis revealed that this ChiVMV isolate shared ~84 to 99% nucleotide identities with other ChiVMV isolates available in GenBank (KC711055 to KF220408). To fulfill Koch's postulates, we isolated this virus by three cycle single lesion isolation in N. tabacum, and mechanically inoculated it onto tomato leaves. The same mottle and leaf distortion symptoms in systemic leaves were observed. Subsequent RT-PCR, fragment clone, and sequence determination tests were repeated and the results were the same. All the evidence from these tests revealed that the two tomato plants were infected by ChiVMV. To our knowledge, this is the first report of ChiVMV naturally infecting tomato in China. It shows that ChiVMV is spreading in China and is naturally infecting a new solanaceous crop in the southwest area, and the spread of the virus may affect tomato crop yields in China. Thus, it is very important to seek an effective way to control this virus. References: (1) M. Ding et al. Plant Dis. 95:357, 2011. (2) J. Wang et al. Plant Dis. 90:377, 2006.
Further Characterization of Maize Chlorotic Mottle Virus and Its Synergistic Interaction with Sugarcane Mosaic Virus in Maize

Qiang Wang,Chao Zhang,Chunyan Wang,Yajuan Qian,Zhenghe Li,Jian Hong,Xueping Zhou

DOI: https://doi.org/10.1038/srep39960

IF: 4.6

2017-01-01

Scientific Reports

Abstract:Maize chlorotic mottle virus (MCMV) was first reported in maize in China in 2009. In this study we further analyzed the epidemiology of MCMV and corn lethal necrosis disease (CLND) in China. We determined that CLND observed in China was caused by co-infection of MCMV and sugarcane mosaic virus (SCMV). Phylogenetic analysis using four full-length MCMV cDNA sequences obtained in this study and the available MCMV sequences retrieved from GenBank indicated that Chinese MCMV isolates were derived from the same source. To screen for maize germplasm resistance against MCMV infection, we constructed an infectious clone of MCMV isolate YN2 (pMCMV) and developed an Agrobacterium-mediated injection procedure to allow high throughput inoculations of maize with the MCMV infectious clone. Electron microscopy showed that chloroplast photosynthesis in leaves was significantly impeded by the co-infection of MCMV and SCMV. Mitochondria in the MCMV and SCMV co-infected cells were more severely damaged than in MCMV-infected cells. The results of this study provide further insight into the epidemiology of MCMV in China and shed new light on physiological and cytopathological changes related to CLND in maize.
First report of tomato yellow mottle-associated virus infecting Solanum nigrum in China

Zhenggang Li,Yafei Tang,Xiaoman She,Guobing Lan,Lin Yu,Zifu He

DOI: https://doi.org/10.1094/PDIS-05-22-1096-PDN

2022-07-08

Abstract:First report of tomato yellow mottle-associated virus infecting Solanum nigrum in China Zhenggang Li, Yafei Tang, Xiaoman She, Guobing Lan, Lin Yu, and Zifu He† Guangdong Provincial Key Laboratory of High Technology for Plant Protection, Plant Protection Research Institute, Guangdong Academy of Agricultural Sciences, Guangzhou, 510640, P. R. China. Tomato yellow mottle-associated virus (TYMaV) is a newly found cytorhabdovirus associated with epinasty of leaflet blades, yellow spots, puckering, and mottling symptoms in tomato plants in China (Xu et al., 2017). In May 2020, Solanum nigrum plants exhibiting leaf crinkling and mosaic symptoms (eXtra S1) were found in Shantou city, Guangdong, China. To identify the causal pathogens, the leaves of three symptomatic plants were collected and subjected to total RNA extraction with TRIzol Reagent (Takara, Kusatsu, Japan). About 100 μg RNA mixture, which consisted of an equal amount of total RNA extracted from the three samples, was subjected to small RNA deep sequencing and assembly (sRSA) (Kreuze et al., 2009). Small RNA cDNA library was constructed with the method described previously (Mi et al., 2008). Small RNA deep sequencing was performed with Illumina HiSeq X Ten platform. VirusDetect (Zheng et al., 2017) was used to analyze the sequence data. The result showed that the sequence data includes about 11 million reads and generated 194 unique contigs after removal of host-derived contigs. Subsequently, the unique contigs were screened using BLASTn search against the virus database. One hundred and five unique contigs were mapped to TYMaV genome (reference sequence, KY075646), 21 unique contigs were mapped to RNA1 segment of tomato chlorosis virus (ToCV) genome (reference sequence, KY618796), 67 unique contigs were mapped to RNA2 segment of ToCV genome (reference sequence, KY618797), and one unique contig was mapped to pepper veinal mottle virus (PVMV) genome (reference sequence, FJ617225) (eXtra S1). To verify the sRSA result for TYMaV detection, RT-PCR was performed with two primer pairs TYMaV-F1/R1 (5'-TCATTAGACTCAGGCCTAATCCTCA AAGT-3'/5'-GATATGGAGACGTCCAAGTTCAAAGGGATGGA-3'), and TYMaV-F2/R2 (5'-TATGCGGCAGCTTTCATGTCTATAGACCCT-3'/5'-ATGACCTAGCTTCAATAACAGTCGCG-3'), which are designed according to the sRSA result. All the symptomatic samples tested positive for TYMaV (eXtra S2). Western blot with TYMaV N protein-specific antibody further verified the result (eXtra S2). To obtain the nearly full-length sequence of TYMaV identified in Shantou, 13 primer pairs were designed to amplify the viral fragments. The amplified PCR products were then introduced into pMD19T (Takara, Kusatsu, Japan) and sequenced by Sangon Biotech Co. (Shanghai, China). The nearly full-length sequence of TYMaV Shantou isolate (TYMaV-ST) was assembled from the 13 overlapping sequences (reference sequence, MW527091). TYMaV-ST genome comprises of 13401 nt and shares 84.93% nucleotide sequence identity with the reference genome (KY075646). In addition, 37 S. nigrum samples and 20 tomato samples nearby with viral disease symptoms were collected from different sites of Guangdong province, China. Six S. nigrum samples and five tomato plant samples tested positive for TYMaV by RT-PCR, suggesting a wide spread of the virus in the surveyed region. These results together with those of the sRSA assay also suggest that the disease symptoms shown in the original S. nigrum plants may not necessarily be caused by TYMaV or by TYMaV alone. To our knowledge, this is the first report of TYMaV infecting S. nigrum in China. S. nigrum is a common weed which belongs to the family Solanaceae and may serve as a reservoir for TYMaV in the fields. Further research is needed to verify whether this is indeed the case, and to understand the characteristics of this virus including its transmission, pathogenicity, and economic significance. The authors declare no conflict of interest. Funding This work was supported by the Key Research and Development Program of Guangdong Province (2018B020202006), the Agricultural Competitive Industry Discipline Team Building Project of Guangdong Academy of Agricultural Sciences (202103TD and 202105TD), the Science and Technology Program of Guangzhou (202102020504), and Special Fund for Scientific Innovation Strategy-Construction of High-Level Academy of Agriculture Science (R2019PY-QF003). References: Kreuze, J. F., et al. 2009. Virology. 388: 1. Mi, S., et al. 2008. Cell. 133: 116. Xu, C., et al. 2017. J Virol. 91: 11. Zheng, Y., et al. 2017. Virology. 500: 130.
First report of Impatiens necrotic spot orthotospovirus infecting Tulbaghia violacia Harv. in China

Jingyu Hu,Lei Zhang,Zhizhong Yang,HuaLi Qian,Zhe Xu,JunJie Hao,PengZhang Ji,Jia Hong Dong

DOI: https://doi.org/10.1094/PDIS-06-22-1325-PDN

2022-08-10

Abstract:Tulbaghia violacea Harv. indigenous to southern African countries, is an herbaceous perennial bulbous plant belonging to the family Amaryllidaceae. It is a popular garden plant in China. This attractive plant is traditionally used as medicine and repellent (Kubec et al. 2002; Moodley et al. 2015). In June 2021, T. violacea plants showing typical tospovirus-like symptoms of chlorotic rings patterns, were found at the campus of Yunnan University of Chinese Medicine (Fig.S1). Disease incidence was about 11.0% during the field survey. Total RNA was extracted from symptomatic leaves of T. violacea plants using the TRIzol reagent (ambio, Carlsbad, CA). Reverse transcription (RT)-PCR was conducted to identify the virus using RNA extract as the template. The degenerate primers (dTospo-F2 and dTospo-R2) (Huang et al. 2018) were used to amplify the conserved regions of the orthotospoviral L RNA sequences. No amplification was obtained from extracts of two asymptomatic plants. The amplicons from four symptomatic samples were cloned into the pMD19-T vector (TaKaRa) and sequenced (three clones for each amplicon) by Tsingke (Shanghai, China). The obtained DNA fragments were determined to be 312 bp. The sequences from four symptomatic samples were identical (GenBank acc.no. OK258285) and shared the highest nucleotide identities (98.0%) with a corresponding sequence of segment L of impatiens necrotic spot virus (INSV) isolated (GQ336991) from Phalaenopsis amabilis in Yunnan province, China. To further confirm the INSV infection to T. violacea, the samples were analyzed with the specific primers for the N, NSs and NSm genes of INSV (Table S1), respectively. Amplicons of the expected size, 789 bp, 1344 bp and 912 bp, were produced, respectively. Amplicons were cloned and sequenced. The 789-bp N (ON529554) and 1344-bp NSs (ON529554) gene sequences had 99.1% and 99.3% nucleotide identities with the corresponding region of previously described INSV Phalenopsis isolate (GQ336989), respectively. The 912-bp NSm (ON529553) gene sequence shared 99.5% nucleotide identity with the corresponding region of INSV Phalenopsis isolate (GQ336990). Metavirome and Sanger sequencing were used to complete the genome of INSV from T. violacea. The leaves of the symptomatic sample were used to construct an rRNA-depleted library using Nextera XT reagents (Illumina, San Diego, CA). The library was subjected to RNA-Seq a NovaSeq 6000 platform (Illumina, San Diego, CA). A total of 33,193,233 quality-filtered reads were obtained using BBMAP (https://github.com/BioInfoTools/BBMapBBMap - Bushnell B. - sourceforge.net/projects/bbmap/). Among 161052 reads mapped to virus sequences, 151407 reads (read ratios 94.0%) were mapped to INSV. Three complete segments of INSV genome were determined to 8,778 nt (L segment, Acc. No. ON529552), 4,958 nt (M segment, Acc. No. ON529553), and 2,983 nt (S segment, Acc. No. ON529554) in length. These segments were validated by RT-PCR and Sanger sequencing. Three segments share nucleotide sequence identities of 99.6%, 99.3% and 98.9% with the L (GQ336991), M (GQ336990) and S segments (GQ336989) of INSV Phalenopsis isolate, respectively. The results of sequence comparisons showed no evidence of reassortment between INSV and another orthotospovirus. There was a report of tomato spotted wilt virus infecting T. violacea in Florida, USA (Dey et al. 2019). No other virus infecting T. violacea was reported. INSV has been reported to infect several economically important crops including Phalenopsis, pepper etc. in China (Chen et al. 2016). INSV-infected T. violacea not only losses landscaping value but also plays an important intermedia host role in the spread of INSV. Additional surveys and evaluation will be needed to understand the potential medicinal effect of this virus on this plant. To our knowledge, this is first report of INSV in T. violacea.

Impact of CLIA 88 on the clinical microbiology laboratory.

Molecular Characterization and Pathogenicity of a Novel Monopartite Geminivirus Infecting Tobacco in China

Acid-base indicators in N,N-dimethylformamide: chromatic parameters of transition ranges.

Characterization Of A Novel Polerovirus Infecting Maize In China

Action of topical thyroid hormone analogue, triiodothyroacetic acid in reversing glucocorticoid-induced skin atrophy in humans.

First Report of Pepper Veinal Mottle Virus Infecting Pepper in Mainland China

First Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium Candidum in China

Genomic Analysis of a Novel Torradovirus "Rehmannia Torradovirus Virus": Two Distinct Variants Infecting Rehmannia glutinosa

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China

First report of pepper chlorosis-associated virus infecting tobacco (Nicotiana tabacum) plants in Sichuan Province in China

Neuroradiology case of the day. Sagittal sinus thrombosis with hemorrhagic venous infarct.

Decompression "Iridopathy" Following Diode Laser Cycloablation.

President-Elect's Message: The Support of Dental Research

Genetic Variation and Population Structure of Cucumber Green Mottle Mosaic Virus.

First Report of Cucumber Green Mottle Mosaic Virus Infecting Zucchini (Cucurbita pepo) and Wax Gourd (Benincasa hispida) in China

[Effects of human dendritic cells derived from CD34(+) cells on the biologic characteristic of bone marrow-derived mesenchymal stem cells].

First Report of Watermelon mosaic virus causing a Mosaic Disease on Cucumis metuliferus in China

First Report of Chilli veinal mottle virus Infecting Tomato (Solanum lycopersicum) in China

Further Characterization of Maize Chlorotic Mottle Virus and Its Synergistic Interaction with Sugarcane Mosaic Virus in Maize

First report of tomato yellow mottle-associated virus infecting Solanum nigrum in China

First report of Impatiens necrotic spot orthotospovirus infecting Tulbaghia violacia Harv. in China