Decompression "Iridopathy" Following Diode Laser Cycloablation.

T. A. Williams,F. Sii,M. Chiang,P. Shah

DOI: https://doi.org/10.3928/15428877-20100216-13

Abstract:

What problem does this paper attempt to address?

Molecular Characterization and Pathogenicity of a Novel Monopartite Geminivirus Infecting Tobacco in China

Yuan Chen,Shiping Guo,Lianqiang Jiang,Fangfang Yan,Kaiqiang Hao,Zhiping Wang,Mengnan An,Zihao Xia,Fangfang Li,Xueping Zhou,Yuanhua Wu

DOI: https://doi.org/10.1016/j.virol.2024.110061

IF: 3.513

2024-01-01

Virology

Abstract:The occurrence of geminiviruses causes significant economic losses in many economically important crops. In this study, a novel geminivirus isolated from tobacco in Sichuan province of China, named tomato leaf curl Chuxiong virus (TLCCxV), was characterized by small RNA-based deep sequencing. The full-length of TLCCxV genome was determined to be 2744 nucleotides (nt) encoding six open reading frames. Phylogenetic and genome-wide pairwise identity analysis revealed that TLCCxV shared less than 91% identities with reported geminiviruses. A TLCCxV infectious clone was constructed and successfully infected Nicotiana benthamiana, N. tabacum, N. glutinosa, Solanum lycopersicum and Petunia hybrida plants. Furthermore, expression of the V2, C1 and C4 proteins through a potato virus X vector caused severe chlorosis or necrosis symptom in N. benthamiana. Taken together, we identified a new geminivirus in tobacco plants, and found that V2, C1 and C4 contribute to symptom development.
First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China

Changjie Li,Yi Liu,Chuanlin Yin,Kai Sun,Guangfu Liu,Pengjun Zhang

DOI: https://doi.org/10.1094/PDIS-09-22-2050-PDN

2022-10-24

Abstract:Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.
First report of tomato yellow mottle-associated virus infecting Solanum nigrum in China

Zhenggang Li,Yafei Tang,Xiaoman She,Guobing Lan,Lin Yu,Zifu He

DOI: https://doi.org/10.1094/PDIS-05-22-1096-PDN

2022-07-08

Abstract:First report of tomato yellow mottle-associated virus infecting Solanum nigrum in China Zhenggang Li, Yafei Tang, Xiaoman She, Guobing Lan, Lin Yu, and Zifu He† Guangdong Provincial Key Laboratory of High Technology for Plant Protection, Plant Protection Research Institute, Guangdong Academy of Agricultural Sciences, Guangzhou, 510640, P. R. China. Tomato yellow mottle-associated virus (TYMaV) is a newly found cytorhabdovirus associated with epinasty of leaflet blades, yellow spots, puckering, and mottling symptoms in tomato plants in China (Xu et al., 2017). In May 2020, Solanum nigrum plants exhibiting leaf crinkling and mosaic symptoms (eXtra S1) were found in Shantou city, Guangdong, China. To identify the causal pathogens, the leaves of three symptomatic plants were collected and subjected to total RNA extraction with TRIzol Reagent (Takara, Kusatsu, Japan). About 100 μg RNA mixture, which consisted of an equal amount of total RNA extracted from the three samples, was subjected to small RNA deep sequencing and assembly (sRSA) (Kreuze et al., 2009). Small RNA cDNA library was constructed with the method described previously (Mi et al., 2008). Small RNA deep sequencing was performed with Illumina HiSeq X Ten platform. VirusDetect (Zheng et al., 2017) was used to analyze the sequence data. The result showed that the sequence data includes about 11 million reads and generated 194 unique contigs after removal of host-derived contigs. Subsequently, the unique contigs were screened using BLASTn search against the virus database. One hundred and five unique contigs were mapped to TYMaV genome (reference sequence, KY075646), 21 unique contigs were mapped to RNA1 segment of tomato chlorosis virus (ToCV) genome (reference sequence, KY618796), 67 unique contigs were mapped to RNA2 segment of ToCV genome (reference sequence, KY618797), and one unique contig was mapped to pepper veinal mottle virus (PVMV) genome (reference sequence, FJ617225) (eXtra S1). To verify the sRSA result for TYMaV detection, RT-PCR was performed with two primer pairs TYMaV-F1/R1 (5'-TCATTAGACTCAGGCCTAATCCTCA AAGT-3'/5'-GATATGGAGACGTCCAAGTTCAAAGGGATGGA-3'), and TYMaV-F2/R2 (5'-TATGCGGCAGCTTTCATGTCTATAGACCCT-3'/5'-ATGACCTAGCTTCAATAACAGTCGCG-3'), which are designed according to the sRSA result. All the symptomatic samples tested positive for TYMaV (eXtra S2). Western blot with TYMaV N protein-specific antibody further verified the result (eXtra S2). To obtain the nearly full-length sequence of TYMaV identified in Shantou, 13 primer pairs were designed to amplify the viral fragments. The amplified PCR products were then introduced into pMD19T (Takara, Kusatsu, Japan) and sequenced by Sangon Biotech Co. (Shanghai, China). The nearly full-length sequence of TYMaV Shantou isolate (TYMaV-ST) was assembled from the 13 overlapping sequences (reference sequence, MW527091). TYMaV-ST genome comprises of 13401 nt and shares 84.93% nucleotide sequence identity with the reference genome (KY075646). In addition, 37 S. nigrum samples and 20 tomato samples nearby with viral disease symptoms were collected from different sites of Guangdong province, China. Six S. nigrum samples and five tomato plant samples tested positive for TYMaV by RT-PCR, suggesting a wide spread of the virus in the surveyed region. These results together with those of the sRSA assay also suggest that the disease symptoms shown in the original S. nigrum plants may not necessarily be caused by TYMaV or by TYMaV alone. To our knowledge, this is the first report of TYMaV infecting S. nigrum in China. S. nigrum is a common weed which belongs to the family Solanaceae and may serve as a reservoir for TYMaV in the fields. Further research is needed to verify whether this is indeed the case, and to understand the characteristics of this virus including its transmission, pathogenicity, and economic significance. The authors declare no conflict of interest. Funding This work was supported by the Key Research and Development Program of Guangdong Province (2018B020202006), the Agricultural Competitive Industry Discipline Team Building Project of Guangdong Academy of Agricultural Sciences (202103TD and 202105TD), the Science and Technology Program of Guangzhou (202102020504), and Special Fund for Scientific Innovation Strategy-Construction of High-Level Academy of Agriculture Science (R2019PY-QF003). References: Kreuze, J. F., et al. 2009. Virology. 388: 1. Mi, S., et al. 2008. Cell. 133: 116. Xu, C., et al. 2017. J Virol. 91: 11. Zheng, Y., et al. 2017. Virology. 500: 130.
First report of pepper chlorosis-associated virus infecting tobacco (Nicotiana tabacum) plants in Sichuan Province in China

Fang Wang,Junyan Zhu,Yonghui Zhang,Ying Chen,Dankan Yan,Zhaoting Zhang,Ke Wang,Kelei Han,Chao Ma,Benguo Zhou,Chuan Tao Xu

DOI: https://doi.org/10.1094/PDIS-01-24-0002-PDN

2024-05-12

Abstract:Tobacco (Nicotiana tabacum) is an economically important crop in China, and more than 30 viruses have been reported to infect tobacco (Yin et al. 2022). In July 2022, we observed interveinal necrosis on tobacco leaves in fields in Sichuan Province (N 27.9172, E 105.6662) (Fig. 1). Total RNA was isolated from multiple leaves of one plant using an RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Extraction Kit (TIANGEN, Beijing, China). Total RNAs were pooled, and a TruSeq Stranded Total RNA with RiboZero Gold Kit (Illumina, San Diego, CA, USA) was used to eliminate ribosomal RNA. An RNA-Seq library was constructed using VAHTS Universal V6 RNA-seq Library Prep (Nanjing Vazyme, China). High-throughput sequencing was performed on the Illumina DNBseq platform (BGI-ShenZhen, China), which yielded 20,102,087 reads with an average length of 150 nt (total size >6 Gb). Unaligned reads were assembled de novo using SPAdes (Bankevich et al. 2012). Contigs with length ≥200 nt were subjected to local BLASTn and BLASTx analyses against the GenBank nt and nr databases, respectively (Wang et al. 2022). A total of 23 contigs were identified through BLASTx (e-value cut-off = 10 -3), ranging from 631 to 1555 bp long, with 82% to 96% coverage to partial genomic sequences of pepper chlorosis-associated virus (PepCaV-Higashitsuno_2021; Accessions: LC719619 to LC719621) and one contig (6459 bp) with 99% similarity to tobacco mosaic virus (Accession: OP525281) isolate DSMZ PV-0109 from Germany. The complete genome sequence of PepCaV was obtained using primers based on the assembled contigs. The 5'- and 3'-terminal regions of the RNA genome were obtained by 5'- and 3'-rapid amplification of cDNA ends. These amplicons were cloned using the pEASY-Blunt Zero Cloning Kit (TRANSGEN, Nangjing, China) and sequenced by Sanger sequencing. Complete genome sequences of tripartite PepCaV from tobacco samples were 7697, 1808, and 1557 nucleotides long (Accession: OR451987 to OR451989) and showed genome organization typical of the genus Ophiovirus in the family Aspiviridae. The complete sequences of RNA1, RNA2 and RNA3 genome segments shared 92.36%, 90.43%, and 95.24%, nucleotide sequence identities, respectively, with the isolate PepCaV-Higashitsuno_2021 pepper isolate (Accession: LC719619 to LC719621) (Shimomoto et al. 2023), but PepCaV has not been reported to infect N. tabacum. In June 2023, 10 plants collected from each place of Macheng (N 27.9094, E 105.6740), Xiangyang (N 28.0936, E 105.6249) and Moni (N 27.8899, E 105.5936) showing interveinal necrosis symptoms were tested using RT-PCR using PepCaV-MP610-F (5'-TGTTCTCTGCTATGCGGTTG -3') and PepCaV-MP610-R (5'-AGCAATCTCGCACCTGAAGT-3') to product 610bp amplicon. Twenty-five tobacco plants were positive for PepCaV. Single sequence from each location was submitted to GenBank (Accession: PP728631 to PP728633). Sap extracts from the original field leaf samples collected from Sichuan Province were used to mechanically inoculate tobacco plants (10 plants) at the four-leaf stage. After 7 days, leaf samples were tested using RT-PCR assay specific to PepCaV and TMV while samples were positive only for TMV but failed to transmit PepCaV by mechanical inoculation. According to previous literature, ophioviruses may be transmitted though soilborne fungus (Jeong et al. 2014). Further research is needed to understand the transmission, epidemiology, and pathological properties of the PepCaV. To our knowledge, this is the first report documenting natural PepCaV infection of tobacco plants in China, providing a scientific basis for PepCaV infection control in tobacco plantations.
[Effects of human dendritic cells derived from CD34(+) cells on the biologic characteristic of bone marrow-derived mesenchymal stem cells].

Yong-feng Su,Siwei Huo,Xiao-Xia Jiang,Yuanlin Liu,Ying Wu,N. Mao,Yi Zhang

2009-08-01

Abstract:This study was purposed to clarify whether biology function of mesenchymal stem cells (MSCs) is changed by suppressing the development of dendritic cells (DC) derived from hematopoietic stem cells (HSCs). MSCs were cocultured with dendritic cells derived from CD34 positive hematopoietic stem cells (HSCs), and then the expression of cytokines and phenotypes of DCs/MSCs were detected by RT-PCR and flow cytometry respectively. Induced experiments were used to analyze the differentiation ability of MSCs. The results showed that DCs/MSCs were negative for the CD14, CD34, CD45, CD31, CD86, but positive for HLA-ABC, CD29, CD73, though the percentage decreased as MSCs vs DCs/MSCs (93.1% vs 13.44%, 98.3% vs 78.8%, 95.3% vs 75.9%). In addition, the expression of cytokines such as M-CSF, TGF-beta increased in DCs/MSCs. After differentiation induction, DCs/MSCs were deprived of the potential to differentiate into adipocytes, but maintained osteogenesis characteristics. It is concluded that the basic characteristics of MSCs are altered after coculture with DCs, and DCs/MSCs result in lower expression of mesenchymal phenotypes and decrease differentiation ability, but increase the expression of cytokines related to hematopoiesis and immunity.
First Report of Chilli veinal mottle virus Infecting Tomato (Solanum lycopersicum) in China

F-F Zhao,D-H Xi,J Liu,X-G Deng,H-H Lin

DOI: https://doi.org/10.1094/PDIS-11-13-1188-PDN

Abstract:Chilli veinal mottle virus (ChiVMV), a potyvirus, is widespread over the world. In China, it was first reported in chili pepper (Capsicum annuum) in Hainan Province (south China) in 2006 (2). Subsequently, it was reported in tobacco (Nicotiana tabacum) in Yunnan Province (southwest China) in 2011 (1). Sichuan Province is one of the largest vegetable producing areas of China. In May 2012, tomatoes with leaves displaying virus-infected symptoms like mottling, mosaic, narrowing, or curling were observed in several fields of Chengdu, eastern Sichuan Province, southwest China. Of the 20 fields we investigated, four fields with 90% tomato plants were infected. During 2012 and 2013, six samples were collected from symptomatic tomato leaves based on different symptoms and locations. All six samples were assayed by western blotting using polyclonal antisera (Cucumber mosaic virus [CMV], Tobacco mosaic virus [TMV]) obtained from Agdia (Elkhart) and one antiserum to ChiVMV obtained from Yunnan Academy of Agricultural Science (China). Two samples from Pengzhou and one sample from Shuangliu exhibiting mosaic leaves were positive for TMV, one sample from Pixian exhibiting narrowing leaves was positive for CMV, and the other two samples from Shuangliu exhibiting mottle and leaf distortion were positive for ChiVMV. Total RNAs was extracted from all six samples and healthy tomato leaves using Trizol reagent (Invitrogen), First-strand cDNA synthesis primed with oligo(dT) by SuperScript III Reverse Transcriptase (Invitrogen). RT-PCR was performed using primer pairs ChiVMV-CP F (5'-GCAGGAGAGAGTGTTGATGCTG-3') and ChiVMV-CP R (5'-(T)16AACGCCAACTATTG-3'), which were designed to direct the amplification of the entire capsid protein (CP) gene and 3' untranslated region (3'-UTR) of ChiVMV (GenBank Accession No. KC711055). The expected 1,166-bp DNA fragment was amplified from the two tomato samples from Shuangliu that were positive for ChiVMV in the western blot tests, but not from the others. The obtained fragments were purified and cloned into the PMD18-T vector (TaKaRa) and sequenced. The sequencing results showed that the two ChiVMV isolates from tomato in Shuangliu were identical (KF738253). Nucleotide BLAST analysis revealed that this ChiVMV isolate shared ~84 to 99% nucleotide identities with other ChiVMV isolates available in GenBank (KC711055 to KF220408). To fulfill Koch's postulates, we isolated this virus by three cycle single lesion isolation in N. tabacum, and mechanically inoculated it onto tomato leaves. The same mottle and leaf distortion symptoms in systemic leaves were observed. Subsequent RT-PCR, fragment clone, and sequence determination tests were repeated and the results were the same. All the evidence from these tests revealed that the two tomato plants were infected by ChiVMV. To our knowledge, this is the first report of ChiVMV naturally infecting tomato in China. It shows that ChiVMV is spreading in China and is naturally infecting a new solanaceous crop in the southwest area, and the spread of the virus may affect tomato crop yields in China. Thus, it is very important to seek an effective way to control this virus. References: (1) M. Ding et al. Plant Dis. 95:357, 2011. (2) J. Wang et al. Plant Dis. 90:377, 2006.
Tomato Leaf Curl Guangxi Virus is a Distinct Monopartite Begomovirus Species

Youping Xu,Xinzhong Cai,Xueping Zhou

DOI: https://doi.org/10.1007/s10658-007-9143-7

2007-01-01

European Journal of Plant Pathology

Abstract:Three begomovirus isolates were obtained from tomato plants showing leaf curl symptoms in Guangxi province of China. Typical begomovirus DNA components representing the three isolates (GX-1, GX-2 and GX-3) were cloned and their full-length sequences were determined to be 2752 nucleotides. Nucleotide identities among the three viral sequences were 98.9–99.7%, but all shared <86.7% nucleotide sequence identity with other reported begomoviruses. The sequence data indicated that GX-1, GX-2 and GX-3 are isolates of a distinct begomovirus species for which the name Tomato leaf curl Guangxi virus (ToLCGXV) is proposed. Further analysis indicated that ToLCGXV probably originated through recombination among viruses related to Ageratum yellow vein virus, Tomato leaf curl China virus and Euphorbia leaf curl virus. PCR and Southern blot analyses demonstrated that isolates GX-1 and GX-2 were associated with DNAβ components, but not isolate GX-3. Sequence comparisons revealed that GX-1 and GX-2 DNAβ components shared the highest sequence identity (86.2%) with that of Tomato yellow leaf curl China virus (TYLCCNV). An infectious construct of ToLCGXV isolate GX-1 (ToLCGXV-GX) was produced and determined to be highly infectious in Nicotiana benthamiana, N. glutinosa, tobacco cvs. Samsun and Xanthi, tomato and Petunia hybrida plants inducing leaf curl and stunting symptoms. Co-inoculation of tomato plants with ToLCGXV-GX and TYLCCNV DNAβ resulted in disease symptoms similar to that caused by ToLCGXV-GX alone or that observed in infected field tomato plants.
Characterization Of A Novel Polerovirus Infecting Maize In China

Sha Chen,Guangzhuang Jiang,Jianxiang Wu,Yong Liu,Yajuan Qian,Xueping Zhou

DOI: https://doi.org/10.3390/v8050120

2016-01-01

Abstract:A novel virus, tentatively named Maize Yellow Mosaic Virus (MaYMV), was identified from the field-grown maize plants showing yellow mosaic symptoms on the leaves collected from the Yunnan Province of China by the deep sequencing of small RNAs. The complete 5642 nucleotide (nt)-long genome of the MaYMV shared the highest nucleotide sequence identity (73%) to Maize Yellow Dwarf Virus-RMV. Sequence comparisons and phylogenetic analyses suggested that MaYMV represents a new member of the genus Polerovirus in the family Luteoviridae. Furthermore, the P0 protein encoded by MaYMV was demonstrated to inhibit both local and systemic RNA silencing by co-infiltration assays using transgenic Nicotiana benthamiana line 16c carrying the GFP reporter gene, which further supported the identification of a new polerovirus. The biologically-active cDNA clone of MaYMV was generated by inserting the full-length cDNA of MaYMV into the binary vector pCB301. RT-PCR and Northern blot analyses showed that this clone was systemically infectious upon agro-inoculation into N. benthamiana. Subsequently, 13 different isolates of MaYMV from field-grown maize plants in different geographical locations of Yunnan and Guizhou provinces of China were sequenced. Analyses of their molecular variation indicate that the 3 half of P3-P5 read-through protein coding region was the most variable, whereas the coat protein- (CP-) and movement protein- (MP-)coding regions were the most conserved.
Occurrence and Distribution of Geminiviruses in Tobacco in Yunnan Province of China

LIU Yong,XIE Yan,LIAO Bai-lu,Roy B.Mugiira,ZHOU Xue-ping

DOI: https://doi.org/10.3321/j.issn:0412-0914.2007.06.002

2007-01-01

Abstract:Three distinct geminivirus species Tobacco curly shoot virus (TbCSV), Tobacco leaf curl Yunnan virus (TbLCYNV) and Tomato yellow leaf curl China virus (TYLCCNV) belonging to the genus Begomovirus have previously been found associated with tobacco leaf curl disease (TLCD) in Yunnan province, China.For determination of their distribution, 109 samples were collected from symptom expressing tobacco plants in fields located in four districts of Yunnan province in the period from 2000 to 2005. Primer pairs specific to each of the three viruses were used to determine their occurrence. PCR detections revealed that all the three viruses occurred in Baoshan district while only TYLCCNV was found in the other three districts (Dali, Wenshan and Honghe ). Mixed infections comprising TbCSV + TbLCYNV, TbCSV + TYLCCNV and TbCSV +TbLYNV + TYLCCNV were found in Baoshan district. Comparisons and phylogenetic analysis of the partial sequences obtained from a total of 39 isolates showed that they clustered into different groups on the basis of virus species and geographical location. The epidemiology of TLCD and the development of strategies for effective disease management were discussed.
First Report of Pea as a Natural Host of tomato mottle mosaic virus in China

Shu Zhang,Guanlin Tan,Fan Li

DOI: https://doi.org/10.1094/PDIS-02-21-0280-PDN

2021-08-19

Abstract:Tomato mottle mosaic virus, a new species in the genus Tobamovirus and family Virgaviridae, was first reported on tomato in Mexico in 2013 (Li et al. 2013). Subsequently, tomato mottle mosaic virus (ToMMV) was found infecting pepper and eggplant in China (Li et al. 2014; Chai et al. 2018). ToMMV was thought to pose a serious risk to solanaceous crops due to its potential to break resistance and numerous transmission ways (Li et al. 2020), meanwhile, some plant species in the families of Amaranthaceae, Brassicaceae, Cucurbitaceae, and Verbenaceae, were found as the hosts of ToMMV under experimental condition (Sui et al. 2017; Li et al. 2020). To clarify the occurrence of ToMMV in Yunnan province of China, 395 plant samples, including tomato (Solanum lycopersicum L.), pepper (Capsicum annuum L.) and pea (Pisum sativum L.), exhibiting viral-like symptoms were collected in major crop plantations in Yunnan province in 2020. Total nucleic acids were extracted from the diseased samples using a CTAB method (Li et al. 2008), and tested by reverse transcription polymerase chain reaction (RT-PCR) with ToMMV specific primers, ToMMVMPF (5'-ATGGCTCTAACTGTTAGTGGT-3') and ToMMVMPR (5'-TTAATACGAATCAGATCCCGCG-3'), which were designed based on the movement protein gene sequence of ToMMV YYMLJ isolate (KR824950). ToMMV was detected in 13 symptomatic samples (11 cherry tomato and 2 green pea plants) with a total detection rate of 3.29%. An 807-bp fragment was amplified from 2 out of 86 pea samples showing foliar chlorosis, mosaic, malformation and necrosis symptoms, and the amplicons were cloned and sequenced. Sequences obtained from the two pea samples were identical. Therefore, one sequence was deposited in the GenBank (accession no. MW561348). BLAST search result showed that the nucleotide sequence had the highest identity of 99.88% with the ToMMV TiLhaLJ isolate (KR824951). The ToMMV infection on the two pea samples was also verified by dot-enzyme immunoassay (Dot-ELISA) using ToMMV monoclonal antibody (kindly provided by Dr. Jianxiang Wu, Zhejiang University, China). To determine the pathogenicity of ToMMV on pea, ToMMV infectious cDNA clone was used to inoculate into 3-week-old healthy pea plants via an Agrobacterium-mediated method (Tu et al. 2021). Mottle or slight mosaic, chlorosis and malformation symptoms were observed on the upper leaves of the 8 out of 12 inoculated plants 8 days postinoculation, and ToMMV could be detected by RT-PCR from the 8 symptomatic plants but not from the asymptomatic and healthy control pea plants with the above described ToMMV specific primer pair. ToMMV has now only been detected in Mexico, China, Spain, USA, Israel and Australia on tomato, pepper and eggplant (Webster et al. 2014; Turina et al. 2016; Ambrós et al. 2017; Lovelock et al. 2020). To the best of our knowledge, this is the first report of natural infection of ToMMV in pea as well as the natural infection of ToMMV on plants outside of the family Solanaceae. The result also implies that ToMMV has a potential risk to more crops in the field. Since pea, pepper and tomato are economically important cash crops in China, proper virus management strategies for the cultivation of these crops should be adopted.
Tobacco Curly Shoot Virus Isolated in Yunnan is a Distinct Species of Begomovirus

Yan Xie,Xueping Zhou,Zhongkai Zhang,Yijun Qi

DOI: https://doi.org/10.1360/02tb9047

2002-01-01

Chinese Science Bulletin

Abstract:Virus isolate Y1 was obtained from tobacco showing curly shoot symptoms in Baoshan, Yunnan Province. Whitefly transmission test and virion morphology observation showed that it is a begomovirus. In reactions with 14 monoclonal antibodies raised against begomoviruses, Y1 was readily differentiated from begomoviruses reported in China, Pakistan and India. The complete nucleotide sequence of DNA-A was determined, it contains 2746 nucleotides, with two ORFs in virion-sense DNA and four ORFs in complementary-sense DNA. Comparisons with total DNA-A, intergenic region and deduced amino acid sequences of individual ORFs showed that Yl is a distinct Begomovirus species, for which the name Tobacco curly shoot virus (TCSV) is proposed. The total DNA-A of TCSV is most closely related to that of Tomato leaf curl virus from India (85% sequence identity). In contrast, the deduced coat protein of TCSV is most like that of Cotton leaf curl virus 72b isolate from Pakistan (98% amino acid sequence identity).
Molecular Characterization of Tomato Yellow Leaf Curl China Virus and Its Satellite DNA Isolated from Tobacco

Yan Xie,Xueping Zhou,Guixin Li

DOI: https://doi.org/10.1007/bf03187049

2003-01-01

Chinese Science Bulletin

Abstract:Virus isolates, Y8, Y36 and Y38, were obtained from tobacco plants showing leaf curl symptoms in Honghe, Yunnan Province. In reactions with 14 monoclonal antibodies raised against Begomovirus particles, Y8, Y36 and Y38 had similar antigenic reaction in TAS-ELISA as Tomato yellow leaf curl China virus (TYLCCNV). The complete DNA-A nucleotide sequences of Y8, Y36 and Y38 were determined and they contain 2727, 2730 and 2730 nucleotides, respectively. Each of the DNA-A sequences has a typical Begomovirus genome organization encoding 6 ORFs with 2 ORFs [AVl(CP) and AV2] in virion-sense DNA and 4 ORFs (AC1 to AC4) in complementary-sense DNA. Comparisons with total DNA-A, intergenic region and deduced amino acid sequences of individual ORFs show that Y8, Y36 and Y38 are isolates of TYLCCNV. Satellite DNA molecules (DNAβ) were found to be associated with Y8, Y36 and Y38, which consist of 1338, 1339 and 1338 nucleotides, respectively. Comparisons show that these DNAβ molecules share 98%–99% sequence identities on nucleotide level and have a common ORF (designated Cl) encoding 126 amino acids on the complementary strand.
First Report of Pepper Veinal Mottle Virus Infecting Pepper in Mainland China

S. B. Zhang,Zijin Zhao,Limin Zheng,D. Y. Zhang,Ye Liu,Jun Liu,Jianxiu Du,Jing Peng,Fei Yan,F. Li,Yan Xie,Zhiyuan Cheng

DOI: https://doi.org/10.1094/pdis-08-15-0870-pdn

IF: 4.5

2016-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 100, No. 5First Report of Pepper veinal mottle virus Infecting Pepper in Mainland China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Pepper veinal mottle virus Infecting Pepper in Mainland ChinaS. B. Zhang, Z. B. Zhao, L. M. Zheng, D. Y. Zhang, Y. Liu, J. Liu, J. Du, J. Peng, F. Yan, F. Li, Y. Xie, and Z. B. ChengS. B. ZhangSearch for more papers by this author, Z. B. ZhaoSearch for more papers by this author, L. M. ZhengSearch for more papers by this author, D. Y. ZhangSearch for more papers by this author, Y. LiuSearch for more papers by this author, J. LiuSearch for more papers by this author, J. DuSearch for more papers by this author, J. PengSearch for more papers by this author, F. YanSearch for more papers by this author, F. LiSearch for more papers by this author, Y. XieSearch for more papers by this author, and Z. B. ChengSearch for more papers by this authorAffiliationsAuthors and Affiliations S. B. Zhang Z. B. Zhao L. M. Zheng D. Y. Zhang Y. Liu J. Liu J. Du J. Peng , Key Laboratory of Pest Management of Horticultural Crop of Hunan Province, Hunan Plant Protection Institute, Hunan Academy of Agricultural Science, Changsha 410125, China F. Yan , Virology and Biotechnology Institute, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China F. Li , Key Laboratory of Agricultural Biodiversity for Pest Management of China Education Ministry, Yunnan Agricultural University, Kunming 650201, China Y. Xie , Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China Z. B. Cheng , Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Nanjing 201014, China. Published Online:29 Feb 2016https://doi.org/10.1094/PDIS-08-15-0870-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Pepper veinal mottle virus (PVMV), a virus species in the genus Potyvirus in the family Potyviridae, has been reported to infect several crops of Solanaceae in several countries and regions of Africa (Huguenot et al. 1996) and East Asia (Taiwan and South Korea) (Ceng et al. 2009; Ha et al. 2008). During a survey of pepper diseases in June 2013, about 15% of red pepper (Capsicum annuum) plants with viral-like symptoms of stunting, veinal chlorosis, and leaf curl and mottle were observed in Changsha, Hunan Province, China. Three diseased plants were collected and tested by high throughput small RNA sequencing (Ho et al. 2014) for pathogen identification. Total RNA was extracted using Trizol reagent (Sangon Biotech, Shanghai, China) from pooled leaf samples of the three plants. Small RNA libraries were constructed using the “Small RNA v1.5 Sample Prep” kit (Illumina, San Diego, CA) and sequenced by high throughput sequencing using a Solexa sequencer (Illumina). Raw data of approximate 8 million reads were analyzed using the Illumina GA Pipeline v1.3. High quality small RNA reads (18 to 30 nt) were assembled to contigs using the software Velvet 1.0.5. A BLASTn search of the resultant contigs to the viral genomes of the GenBank database identified about 300 contigs with high nucleotide sequence homologies (>96%) to seven viruses, among which PVMV was matched by 16 contigs with high identities (>98%). To confirm the presence of PVMV, the samples were tested by reverse transcription (RT)-PCR using a primer pair PMF (5′-AATTAAGCCATTGATTGACCA-3′) and PMR (5′-AGCGCCAATTATGAAACCGC-3′), and a ∼744-bp fragment of partial coat protein gene of PVMV was amplified from three symptomatic samples, but not from a healthy pepper sample. The DNA fragment from a selected sample was sequenced and deposited under GenBank Accession No. KT285204. This fragment shared 99% nucleotide identity with a PVMV isolate from South Korea (DQ645484). Northern blot using a digoxigenin-labeled PCR fragment amplified by primers PMF and PMR also confirmed the presence of PVMV from an infected plant. To our best knowledge, this is the first report of PVMV naturally infecting pepper in mainland China.References:Ceng, Y. H., et al. 2009. Plant Dis. 93:107. Google ScholarHa, J. H., et al. 2008. Arch. Virol. 153:2315. https://doi.org/10.1007/s00705-008-0245-0 Crossref, ISI, Google ScholarHo, T., et al. 2014. Virology 471-473:54. https://doi.org/10.1016/j.virol.2014.09.019 Crossref, ISI, Google ScholarHuguenot, C., et al. 1996. J. Phytopathol. 144:29. https://doi.org/10.1111/j.1439-0434.1996.tb01484.x Crossref, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 100, No. 5 May 2016SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 15 Apr 2016Published: 29 Feb 2016First Look: 5 Nov 2015Accepted: 19 Oct 2015 Pages: 1025-1025 Information© 2016 The American Phytopathological SocietyCited byPepper veinal mottle virusCABI Compendium, Vol. CABI CompendiumIdentification of a novel pepper-infecting monopartite begomovirus in China20 March 2021 | Archives of Virology, Vol. 166, No. 6Capsicum annuum and Capsicum frutescens (Bell pepper, Chilli, Pepper, Sweet pepper)6 June 2020
Genetic Structure and Population Variability of Tomato Yellow Leaf Curl China Virus.

Linmei Ge,Jiangtao Zhang,Xueping Zhou,Hongye Li

DOI: https://doi.org/10.1128/jvi.02431-06

IF: 6.549

2007-01-01

Journal of Virology

Abstract:Geminiviruses have circular single-stranded DNA genomes and are important pathogens in tropical and subtropical regions, but their population diversity and variability are poorly understood. Here, we have investigated variations accumulating in Tomato yellow leaf curl China virus (TYLCCNV), a geminivirus in the genus Begomovirus of the family Geminiviridae. The population variation was analyzed in a naturally infected tomato (Solanum lycopersicom) plant and in Nicotiana benthamiana and tomato plants experimentally infected with a swarm of TYLCCNV DNA clones to provide an identical sequence for initiation of infection. Our results demonstrate that the population of TYLCCNV in a naturally infected tomato plant was genetically heterogeneous and that rapid mutation occurred in the populations amplified from N. benthamiana and tomato plants that had been infected with cloned DNA. This feature of the population of TYLCCNV in these plants consisted of the consensus sequence and a pool of mutants that are not identical but are closely related to the consensus sequence, and it coincides with the quasispecies concept described for many RNA viruses. The mutation frequency was circa 10(-4) in N. benthamiana and tomato at 60 days postinoculation, a value comparable to that reported for plant RNA viruses. The quasispecies-like nature of the TYLCCNV populations suggested that TYLCCNV is capable of rapid evolution and adaptation in response to changing agricultural practices.
Serological Identification of Viruses Infecting Tobacco in Major Tobacco Growing Areas of China

Zhaopeng LUO,Jun YANG,Ran WANG,Feng LI,Lifeng JIN,Chunyang WEI,Fucheng LIN

DOI: https://doi.org/10.3969/j.issn.1002-0861.2012.12.016

2012-01-01

Abstract:In order to better understand the occurrence of tobacco virus diseases in China status quo,409 symptomatic tobacco samples were collected from 13 major tobacco growing areas of China in 2010 and 2011.Tobacco mosaic virus(TMV),cucumber mosaic virus(CMV),potato virus Y(PVY) and tobacco etch virus(TEV) were detected by ELISA(enzyme-1inked immunosorbent assay).The results showed that the infection rate of TMV was the highest,which was 64.6% and 48.2% in 2010 and 2011,respectively;that of CMV was 32.1% and 28.2%,respectively;and that of PVY was 15.6% and 11.4%,respectively;while that of TEV was the lowest.There presented 7 types of mixed infection.The mixed infection of TMV+CMV topped the highest rate of 34.9% and 28.6% in 2010 and 2010,respectively.It indicated that TMV and CMV were the predominant viruses infecting tobacco in China,and the mixed infection occurred seriously in tobacco field.
Tomato yellow leaf curl Thailand virus-[Y72] from Yunnan is a monopartite begomovirus associated with DNAβ

Wei Guo,Xiuling Yang,Yan Xie,Xiaofeng Cui,Xueping Zhou

DOI: https://doi.org/10.1007/s11262-009-0327-4

2009-01-01

Virus Genes

Abstract:Previous studies have shown that isolates of tomato yellow leaf curl Thailand virus (TYLCTHV) originated from Thailand are bipartite begomoviruses, while all the seven TYLCTHV isolates found in China are associated with DNAβ molecules. In this study, infectious clones of TYLCTHV isolate Y72 (TYLCTHV-[Y72]) and its DNAβ were constructed to verify the bipartite or monopartite nature of TYLCTHV. Agroinoculation showed that TYLCTHV-[Y72] alone was able to induce significant symptoms in Nicotiana benthamiana , Nicotiana glutinosa , and Solanum lycopersicum plants, but co-inoculation with its associated satellite DNAβ produced more severe symptoms, which is similar to tobacco curly shoot virus. Southern blot results showed that TYLCTHV DNAβ could increase the virus accumulation in systemically infected tissues. Thus, TYLCTHV-[Y72] is a monopartite begomovirus, which may represent an evolutionary intermediate between the begomoviruses requiring DNAβ and begomoviruses dispensable of DNAβ.
Molecular variability and evolution of a natural population of tomato yellow leaf curl virus in Shanghai, China

Xiu-ling Yang,Meng-ning Zhou,Ya-juan Qian,Yan Xie,Xue-ping Zhou

DOI: https://doi.org/10.1631/jzus.B1300110

2014-01-01

Abstract:Tomato yellow leaf curl virus (TYLCV), belonging to the genus Begomovirus of the family Geminiviridae, is emerging as the most destructive pathogen of tomato plants. Since the first report of TYLCV in Shanghai, China in 2006, TYLCV has spread rapidly to 13 provinces or autonomous regions of China. In this study, the molecular variability and evolution of TYLCV were monitored in Shanghai from its first upsurge in 2006 until 2010. Full-length genomic sequences of 26 isolates were obtained by rolling circle amplification. Sequence analysis showed that the intergenic region was the most variable, with a mean mutation rate of 4.81×10 −3 nucleotide substitutions per site per year. Genetic differentiation was found within isolates obtained from 2006, 2009, and 2010, though a linear increase in genetic diversity over time was not evident. Whilst significant parts of TYLCV genes were under negative selection, the C4 gene embedded entirely within the C1 gene had a tendency to undergo positive selection. Our results indicate that a mechanism of independent evolution of overlapping regions could apply to the natural population of TYLCV in Shanghai, China.
Acid-base indicators in N,N-dimethylformamide: chromatic parameters of transition ranges.

J. Barbosa,C. M. Bosch

DOI: https://doi.org/10.1016/0039-9140(91)80109-D

1991-11-01

Abstract:
Distinct tomato yellow leaf curl Chuxiong virus isolated from whiteflies and plants in China and its symptom determinant and suppressor of post-transcriptional gene silencing

Yan Xie,Xianan Liu,Chaohu Luo,Qianqian Hu,Xuan Che,Liling Zhao,Min Zhao,Liqi Wu,Ming Ding

DOI: https://doi.org/10.1016/j.virol.2024.110040

IF: 3.513

2024-03-07

Virology

Abstract:A begomovirus isolated from whiteflies ( Bemisia tabaci ) and tomato, sweet potato in China was found to be representative of a distinct begomovirus species, for which the name tomato yellow leaf curl Chuxiong virus (TYLCCxV) is proposed. The results of genomic identification and sequence comparison showed that TYLCCxV shares the highest complete nucleotide sequence identity (88.3%) with croton yellow vein mosaic virus (CroYVMV), and may have originated from the recombination between synedrella leaf curl virus (SyLCV) and squash leaf curl Yunnan virus (SLCuYV). Agrobacterium-mediated inoculation showed that TYLCCxV is highly infectious for a range of plant species, producing upward leaf curling, leaf crumpling, chlorosis, distortion, and stunt symptoms in Solanum lycopersicum plants. The results of Southern blot indicated that TYLCCxV is capable of efficiently replicating two heterologous betasatellites. The inoculation of PVX::C4 on Nicotiana benthamiana induced upward leaf curling and stem elongation symptoms, suggesting that TYLCCxV C4 functions as a symptom determinant. TYLCCxV V2 is an important virulence factor that induces downward leaf curling symptoms, elicits systemic necrosis, and suppresses local and systemic GFP silencing in co-agroinfiltrated N. benthamiana and transgenic 16c plants. Considering the multifunctional virulence proteins V2 and C4, the possibility of TYLCCxV causing devastating epidemics on tomato in China is discussed.

virology
Molecular Characterization and Pathogenicity of Tomato Yellow Leaf Curl Virus in China

Hui Zhang,Huanran Gong,Xueping Zhou

DOI: https://doi.org/10.1007/s11262-009-0384-8

2009-01-01

Virus Genes

Abstract:Several tomato production regions in China were surveyed for tomato yellow leaf curl disease (TYLCD), and 31 tomato leaf samples showing TYLCD-like symptoms were collected. The partial or full-length genomes of these isolates were sequenced and tomato yellow leaf curl virus (TYLCV) was detected in Shanghai, Zhejiang, Jiangsu Shandong and Hebei provinces of China. The TYLCV isolates found in China share high sequence identity (>98%) and have more than 97% sequence identity with TYLCV-IL[IL:Reo] (X15656). Phylogenetic relationship analysis reveals that although with little genetic variability, they can form two groups and all the TYLCV isolates in China belong to the group I. An infectious clone of TYLCV-[CN:SH2] (AM282874) was constructed and agro-inoculated into Nicotiana benthamiana, N. tabacum Samsun, N. glutinosa, Solanum lycopersicum, Petunia hybrida, Cucumis sativus, Gossypium hirsutum, S. melongena, and Capsicum annuum. TYLCV-[CN:SH2] can induce severe leaf curling and stunting symptoms in these plants except C. sativus, G. hirsutum, S. melongena and C. annuum. We verified that TYLCV can trans-replicate tomato yellow leaf curl China virus DNA-β in N. benthamiana and S. lycopersicum and induced more severe symptoms with distortion and yellow vein.

Decompression "Iridopathy" Following Diode Laser Cycloablation.

Molecular Characterization and Pathogenicity of a Novel Monopartite Geminivirus Infecting Tobacco in China

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China

First report of tomato yellow mottle-associated virus infecting Solanum nigrum in China

First report of pepper chlorosis-associated virus infecting tobacco (Nicotiana tabacum) plants in Sichuan Province in China

[Effects of human dendritic cells derived from CD34(+) cells on the biologic characteristic of bone marrow-derived mesenchymal stem cells].

First Report of Chilli veinal mottle virus Infecting Tomato (Solanum lycopersicum) in China

Tomato Leaf Curl Guangxi Virus is a Distinct Monopartite Begomovirus Species

Characterization Of A Novel Polerovirus Infecting Maize In China

Occurrence and Distribution of Geminiviruses in Tobacco in Yunnan Province of China

First Report of Pea as a Natural Host of tomato mottle mosaic virus in China

Tobacco Curly Shoot Virus Isolated in Yunnan is a Distinct Species of Begomovirus

Molecular Characterization of Tomato Yellow Leaf Curl China Virus and Its Satellite DNA Isolated from Tobacco

First Report of Pepper Veinal Mottle Virus Infecting Pepper in Mainland China

Genetic Structure and Population Variability of Tomato Yellow Leaf Curl China Virus.

Serological Identification of Viruses Infecting Tobacco in Major Tobacco Growing Areas of China

Tomato yellow leaf curl Thailand virus-[Y72] from Yunnan is a monopartite begomovirus associated with DNAβ

Molecular variability and evolution of a natural population of tomato yellow leaf curl virus in Shanghai, China

Acid-base indicators in N,N-dimethylformamide: chromatic parameters of transition ranges.

Distinct tomato yellow leaf curl Chuxiong virus isolated from whiteflies and plants in China and its symptom determinant and suppressor of post-transcriptional gene silencing

Molecular Characterization and Pathogenicity of Tomato Yellow Leaf Curl Virus in China