Acid-base indicators in N,N-dimethylformamide: chromatic parameters of transition ranges.

J. Barbosa,C. M. Bosch

DOI: https://doi.org/10.1016/0039-9140(91)80109-D

1991-11-01

Abstract:

What problem does this paper attempt to address?

Genetic Variation and Population Structure of Cucumber Green Mottle Mosaic Virus.

Li-xia Rao,Yushuang Guo,Li-li Zhang,Xue-ping Zhou,Jian Hong,Jian-xiang Wu

DOI: https://doi.org/10.1007/s00705-016-3207-y

IF: 2.685

2017-01-01

Archives of Virology

Abstract:Cucumber green mottle mosaic virus (CGMMV) is a single-stranded, positive sense RNA virus infecting cucurbitaceous plants. In recent years, CGMMV has become an important pathogen of cucurbitaceous crops including watermelon, pumpkin, cucumber and bottle gourd in China, causing serious losses to their production. In this study, we surveyed CGMMV infection in various cucurbitaceous crops grown in Zhejiang Province and in several seed lots purchased from local stores with the dot enzyme-linked immunosorbent assay (dot-ELISA), using a CGMMV specific monoclonal antibody. Seven CGMMV isolates obtained from watermelon, grafted watermelon or oriental melon samples were cloned and sequenced. Identity analysis showed that the nucleotide identities of the seven complete genome sequences ranged from 99.2 to 100%. Phylogenetic analysis of seven CGMMV isolates as well as 24 other CGMMV isolates from the GenBank database showed that all CGMMV isolates could be grouped into two distinct monophyletic clades according to geographic distribution, i.e. Asian isolates for subtype I and European isolates for subtype II, indicating that population diversification of CGMMV isolates may be affected by geographical distribution. Site variation rate analysis of CGMMV found that the overall variation rate was below 8% and mainly ranged from 2 to 5%, indicating that the CGMMV genomic sequence was conservative. Base substitution type analysis of CGMMV showed a mutational bias, with more transitions (A↔G and C↔T) than transversions (A↔C, A↔T, G↔C and G↔T). Most of the variation occurring in the CGMMV genome resulted in non-synonymous substitutions, and the variation rate of some sites was higher than 30% because of this mutational bias. Selection constraint analysis of CGMMV ORFs showed strong negative selection acting on the replication-associated protein, similar to what occurs for other plant RNA viruses. Finally, potential recombination analysis identified isolate Ec as a recombinant with a low degree of confidence.
Molecular Characterization and Pathogenicity of a Novel Monopartite Geminivirus Infecting Tobacco in China

Yuan Chen,Shiping Guo,Lianqiang Jiang,Fangfang Yan,Kaiqiang Hao,Zhiping Wang,Mengnan An,Zihao Xia,Fangfang Li,Xueping Zhou,Yuanhua Wu

DOI: https://doi.org/10.1016/j.virol.2024.110061

IF: 3.513

2024-01-01

Virology

Abstract:The occurrence of geminiviruses causes significant economic losses in many economically important crops. In this study, a novel geminivirus isolated from tobacco in Sichuan province of China, named tomato leaf curl Chuxiong virus (TLCCxV), was characterized by small RNA-based deep sequencing. The full-length of TLCCxV genome was determined to be 2744 nucleotides (nt) encoding six open reading frames. Phylogenetic and genome-wide pairwise identity analysis revealed that TLCCxV shared less than 91% identities with reported geminiviruses. A TLCCxV infectious clone was constructed and successfully infected Nicotiana benthamiana, N. tabacum, N. glutinosa, Solanum lycopersicum and Petunia hybrida plants. Furthermore, expression of the V2, C1 and C4 proteins through a potato virus X vector caused severe chlorosis or necrosis symptom in N. benthamiana. Taken together, we identified a new geminivirus in tobacco plants, and found that V2, C1 and C4 contribute to symptom development.
First Report of Cucumber Green Mottle Mosaic Virus Infecting Zucchini (Cucurbita pepo) and Wax Gourd (Benincasa hispida) in China

Xiaohui Sun,Bin Wu,Shanshan Jiang,Hao Hong,Zhimei Xin,Mei Zhang,Shengji Wang,Xiaoping Zhu,Xiangqi Xin

DOI: https://doi.org/10.1094/PDIS-05-23-0881-PDN

2023-07-19

Abstract:Cucumber green mottle mosaic virus (CGMMV) was first discovered in China in 2003 and caused an epidemic in 2005. In China, the virus has been reported in gourd crops including watermelons, cucumbers, melons, etc (Sui et al. 2019). In Shandong Province, China from September 2014 to 2017, approximately 30% of zucchini (Cucurbita pepo) and wax gourd (Benincasa hispida) plants in commercial cucurbit fields, the two most important cash crops, exhibited chlorosis, mosaic, and mottling symptoms suspected to be caused by a tobamovirus. To identify the causative pathogens, ten zucchini and 15 wax gourd samples were collected from the commercial cucurbit fields. Total RNA was extracted and all samples were tested using reverse transcription PCR (RT-PCR) with TobamodF/TobamodR and TobamodF2/TobamodR2 (Li et al. 2018a). Five common Cucurbitaceae viruses were also tested: cucumber mosaic virus, papaya ringspot virus, squash mosaic virus, watermelon mosaic virus, and zucchini yellow mosaic virus (Ali et al. 2012). All samples generated positive results using tobamovirus generic primers but were negative for the five common Cucurbitaceae viruses. Amplification products (880 bp) from all samples were inserted into pMD19-T and recombinant clones were selected for Sanger sequencing. The results showed that zucchini green mottle mosaic virus, CGMMV, and tobacco mosaic virus (TMV) were detected in zucchini samples. CGMMV and TMV were detected in the wax gourd samples. To confirm the presence of these viruses, RT-PCR was performed using specific primer pairs, including CGMMV-cpf/CGMMV-cpr (Chen et al. 2006), ZG-F/ZG-R (Li et al. 2018b), and TMV-CP-F/TMV-CP-R (Srivastava et al. 2015). CGMMV was detected in all samples, with four zucchini and nine wax gourds only containing CGMMV. Zucchini (n=4; CGZ1-CGZ4) and wax gourd (n=4; CGWX1-CGWX4) isolates were cloned into pMD19-T and sequenced bidirectionally. The BLASTn results confirmed the presence of CGMMV, and the sequencing results were processed using DNAMAN Version (Lynnon Biosoft, San Ramon, CA, USA) and submitted to the GenBank database (https://www.ncbi.nlm.nih.gov/). A phylogenetic tree based on the CGMMV coat protein (CP) was constructed using CGZ1-CGZ4 (OP779762-OP779765), CGWX1-CGWX4 (OP779766-OP779769), and representative CGMMV sequences from GenBank. Sequence analysis of the CP demonstrated that CGMMV-zucchini and -wax gourd isolates belonged to an independent branch of the Chinese muskmelon AH-FT197 isolate (KU175639) and had 100% identity with the AH-FT197 isolate. To confirm their infectivity, leaf sap extract of CGZ4 and CGWX4 in phosphate buffer (0.1 M, pH 7.0) was mechanically inoculated on leaves of virus-free zucchini seedlings (Cucurbita pepo cv. Zaoqingyidai, 4-leaf-stage, n = 10) or virus-free wax gourd seedlings (Benincasa hispida cv. Tiezhu 2, n = 10). Ten days after inoculation, all plants exhibited symptoms (systemic chlorosis, mosaic, and mottling) similar to those of diseased plants in the field. Control seedlings inoculated with phosphate buffer remained symptomless. RT-PCR analysis using the CGMMV-cpf/CGMMV-cpr primer confirmed that all ten zucchini or wax gourd seedlings were infected with CGMMV, and all the control plants were free from CGMMV. To the best of our knowledge, this is the first report on zucchini and wax gourd as natural hosts for CGMMV in China. CGMMV is a highly contagious seed-borne virus and further attention should be paid to its spread in cucurbit crops.
Impact of CLIA 88 on the clinical microbiology laboratory.

K. Chapin,E. Baron

DOI: https://doi.org/10.1016/0732-8893(95)00152-2

IF: 2.983

1995-09-01

Diagnostic Microbiology and Infectious Disease

Abstract:
Characterization Of A Novel Polerovirus Infecting Maize In China

Sha Chen,Guangzhuang Jiang,Jianxiang Wu,Yong Liu,Yajuan Qian,Xueping Zhou

DOI: https://doi.org/10.3390/v8050120

2016-01-01

Abstract:A novel virus, tentatively named Maize Yellow Mosaic Virus (MaYMV), was identified from the field-grown maize plants showing yellow mosaic symptoms on the leaves collected from the Yunnan Province of China by the deep sequencing of small RNAs. The complete 5642 nucleotide (nt)-long genome of the MaYMV shared the highest nucleotide sequence identity (73%) to Maize Yellow Dwarf Virus-RMV. Sequence comparisons and phylogenetic analyses suggested that MaYMV represents a new member of the genus Polerovirus in the family Luteoviridae. Furthermore, the P0 protein encoded by MaYMV was demonstrated to inhibit both local and systemic RNA silencing by co-infiltration assays using transgenic Nicotiana benthamiana line 16c carrying the GFP reporter gene, which further supported the identification of a new polerovirus. The biologically-active cDNA clone of MaYMV was generated by inserting the full-length cDNA of MaYMV into the binary vector pCB301. RT-PCR and Northern blot analyses showed that this clone was systemically infectious upon agro-inoculation into N. benthamiana. Subsequently, 13 different isolates of MaYMV from field-grown maize plants in different geographical locations of Yunnan and Guizhou provinces of China were sequenced. Analyses of their molecular variation indicate that the 3 half of P3-P5 read-through protein coding region was the most variable, whereas the coat protein- (CP-) and movement protein- (MP-)coding regions were the most conserved.
First Report of Pepper Veinal Mottle Virus Infecting Pepper in Mainland China

S. B. Zhang,Zijin Zhao,Limin Zheng,D. Y. Zhang,Ye Liu,Jun Liu,Jianxiu Du,Jing Peng,Fei Yan,F. Li,Yan Xie,Zhiyuan Cheng

DOI: https://doi.org/10.1094/pdis-08-15-0870-pdn

IF: 4.5

2016-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 100, No. 5First Report of Pepper veinal mottle virus Infecting Pepper in Mainland China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Pepper veinal mottle virus Infecting Pepper in Mainland ChinaS. B. Zhang, Z. B. Zhao, L. M. Zheng, D. Y. Zhang, Y. Liu, J. Liu, J. Du, J. Peng, F. Yan, F. Li, Y. Xie, and Z. B. ChengS. B. ZhangSearch for more papers by this author, Z. B. ZhaoSearch for more papers by this author, L. M. ZhengSearch for more papers by this author, D. Y. ZhangSearch for more papers by this author, Y. LiuSearch for more papers by this author, J. LiuSearch for more papers by this author, J. DuSearch for more papers by this author, J. PengSearch for more papers by this author, F. YanSearch for more papers by this author, F. LiSearch for more papers by this author, Y. XieSearch for more papers by this author, and Z. B. ChengSearch for more papers by this authorAffiliationsAuthors and Affiliations S. B. Zhang Z. B. Zhao L. M. Zheng D. Y. Zhang Y. Liu J. Liu J. Du J. Peng , Key Laboratory of Pest Management of Horticultural Crop of Hunan Province, Hunan Plant Protection Institute, Hunan Academy of Agricultural Science, Changsha 410125, China F. Yan , Virology and Biotechnology Institute, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China F. Li , Key Laboratory of Agricultural Biodiversity for Pest Management of China Education Ministry, Yunnan Agricultural University, Kunming 650201, China Y. Xie , Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China Z. B. Cheng , Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Nanjing 201014, China. Published Online:29 Feb 2016https://doi.org/10.1094/PDIS-08-15-0870-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Pepper veinal mottle virus (PVMV), a virus species in the genus Potyvirus in the family Potyviridae, has been reported to infect several crops of Solanaceae in several countries and regions of Africa (Huguenot et al. 1996) and East Asia (Taiwan and South Korea) (Ceng et al. 2009; Ha et al. 2008). During a survey of pepper diseases in June 2013, about 15% of red pepper (Capsicum annuum) plants with viral-like symptoms of stunting, veinal chlorosis, and leaf curl and mottle were observed in Changsha, Hunan Province, China. Three diseased plants were collected and tested by high throughput small RNA sequencing (Ho et al. 2014) for pathogen identification. Total RNA was extracted using Trizol reagent (Sangon Biotech, Shanghai, China) from pooled leaf samples of the three plants. Small RNA libraries were constructed using the “Small RNA v1.5 Sample Prep” kit (Illumina, San Diego, CA) and sequenced by high throughput sequencing using a Solexa sequencer (Illumina). Raw data of approximate 8 million reads were analyzed using the Illumina GA Pipeline v1.3. High quality small RNA reads (18 to 30 nt) were assembled to contigs using the software Velvet 1.0.5. A BLASTn search of the resultant contigs to the viral genomes of the GenBank database identified about 300 contigs with high nucleotide sequence homologies (>96%) to seven viruses, among which PVMV was matched by 16 contigs with high identities (>98%). To confirm the presence of PVMV, the samples were tested by reverse transcription (RT)-PCR using a primer pair PMF (5′-AATTAAGCCATTGATTGACCA-3′) and PMR (5′-AGCGCCAATTATGAAACCGC-3′), and a ∼744-bp fragment of partial coat protein gene of PVMV was amplified from three symptomatic samples, but not from a healthy pepper sample. The DNA fragment from a selected sample was sequenced and deposited under GenBank Accession No. KT285204. This fragment shared 99% nucleotide identity with a PVMV isolate from South Korea (DQ645484). Northern blot using a digoxigenin-labeled PCR fragment amplified by primers PMF and PMR also confirmed the presence of PVMV from an infected plant. To our best knowledge, this is the first report of PVMV naturally infecting pepper in mainland China.References:Ceng, Y. H., et al. 2009. Plant Dis. 93:107. Google ScholarHa, J. H., et al. 2008. Arch. Virol. 153:2315. https://doi.org/10.1007/s00705-008-0245-0 Crossref, ISI, Google ScholarHo, T., et al. 2014. Virology 471-473:54. https://doi.org/10.1016/j.virol.2014.09.019 Crossref, ISI, Google ScholarHuguenot, C., et al. 1996. J. Phytopathol. 144:29. https://doi.org/10.1111/j.1439-0434.1996.tb01484.x Crossref, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 100, No. 5 May 2016SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 15 Apr 2016Published: 29 Feb 2016First Look: 5 Nov 2015Accepted: 19 Oct 2015 Pages: 1025-1025 Information© 2016 The American Phytopathological SocietyCited byPepper veinal mottle virusCABI Compendium, Vol. CABI CompendiumIdentification of a novel pepper-infecting monopartite begomovirus in China20 March 2021 | Archives of Virology, Vol. 166, No. 6Capsicum annuum and Capsicum frutescens (Bell pepper, Chilli, Pepper, Sweet pepper)6 June 2020
First Report of Root-knot Nematode, Meloidogyne Graminicola, on Rice in Zhejiang, Eastern China

Z. L. Tian,E. M. Barsalote,X. L. Li,R. H. Cai,J. W. Zheng

DOI: https://doi.org/10.1094/pdis-06-17-0832-pdn

IF: 4.5

2017-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 101, No. 12First Report of Root-knot Nematode, Meloidogyne graminicola, on Rice in Zhejiang, Eastern China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Root-knot Nematode, Meloidogyne graminicola, on Rice in Zhejiang, Eastern ChinaZ. L. Tian, E. M. Barsalote, X. L. Li, R. H. Cai, and J. W. ZhengZ. L. Tian, E. M. Barsalote, X. L. Li, R. H. Cai, and J. W. Zheng†Corresponding author: J. W. Zheng; E-mail: E-mail Address: [email protected]AffiliationsAuthors and Affiliations Z. L. Tian E. M. Barsalote X. L. Li R. H. Cai J. W. Zheng † , Ministry of Agriculture Key Lab of Molecular Biology of Crop Pathogens and Insects, Institute of Biotechnology, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310058, China. Published Online:4 Oct 2017https://doi.org/10.1094/PDIS-06-17-0832-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Root-knot nematode, Meloidogyne graminicola, is a destructive pest of rice worldwide (Mantelin et al. 2017). During May 2016, rice plants in irrigated fields in Jinhua, Zhejiang Province, eastern China, showed symptoms of root-knot nematode infestations; above ground symptoms were stunted growth and leaf chlorosis while infected root tips became swollen and hooked. Several pear shaped females of Meloidogyne sp. were observed with gelatinous egg masses often completely embedded inside the root galls. The perineal pattern of the females(n = 9) was oval-shaped with low and round dorsal arches, and striae were smooth and sometimes few lines converge at either end of vulva. Lateral fields obscure or absent. Measurements (mean ±sd, range) of J2 (n = 20): body length (456.7 ± 31. 8 µm, 402.7 to 509.0 µm), stylet (12.1 ± 0.7 µm, 10.6 to 13.1 µm), tail length (70.2 ± 6.1 µm, 61.2 to 79.8 µm) and hyaline tail terminus (19.5 ± 1.8 µm, 16.5 to 22.6 µm); male (n = 17) abundant, body cylindrical and fairly long (1,270 ± 158.8 µm, 1,043.4 to 1,553.4 µm), stylet (17.2 ± 1.0 µm, 15.2 to 18.9 µm), and spicule (21.1 ± 0.8 µm, 20.1 to 21.9 µm). Seven individual females were transferred to seven different tubes for DNA extraction. The D2/D3 region of 28S RNA was amplified with D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and D3B (5′-TCGGAAGGAACCAGCTACTA-3′) (De Ley et al. 1999) yielded a PCR fragment of 766 bp. The ITS region was amplified with AB28 (5′-ATATGCTTAAGTTCAGCGGGT-3′) and TW81 (5′-GTTTCCGTAGGTGAACCTGC-3′) (Curran et al. 1994) yielded a PCR fragment of 579 bp. BLAST results of D2/D3 region of 28S RNA and ITS sequences exhibited 99 to 100% similarity with those of M. graminicola isolates available in GenBank. The sequences of this study were deposited in GenBank (28S D2/D3 accession no. KY660544–KY660545, ITS accession no. KY660542–KY660543). Both morphological and molecular characterization confirmed the status of this nematode as M. graminicola. To assess reproductive rate of M. graminicola, a 2-week-old rice seedling (Oryza sativa cv. Xiushui 11) was individually transplanted in a standard tube (25 mm × 95 mm) containing 10 ml Pluronic F-127 medium, inoculated with 100 second stage juveniles, and incubated in a growth chamber under 16/8 h light/dark photoperiod at 28/26°C for 15 days (Cappello et al. 2016). There were 21 inoculated replicates and 11 noninoculated as control. The egg masses were examined 15 days after inoculation and the multiplication factor [(number of egg masses × number of eggs per egg mass)/nematode inoculum level] values were 8.94 to 11.58. All inoculated plants were stunted and leaves became chlorotic, galls were observed on roots, and root tips become hook-shaped. No galls were found on the control roots. All the parameters confirmed the pathogenicity of the isolated M. graminicola population on rice. To our knowledge, this is the first report of M. graminicola in Zhejiang Province, which is one of the major rice growing area in eastern China.References:Cappello, V., et al. 2016. Sci. Rep. 6:1. https://doi.org/10.1038/s41598-016-0001-8 Crossref, ISI, Google ScholarCurran, J., et al. 1994. Mycol. Res. 98:547. https://doi.org/10.1016/S0953-7562(09)80478-4 Crossref, ISI, Google ScholarDe Ley, P., et al. 1999. Nematology 1:591. https://doi.org/10.1163/156854199508559 Crossref, ISI, Google ScholarMantelin, S., et al. 2017. Mol. Plant Pathol. 18:3. https://doi.org/10.1111/mpp.12394 Crossref, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 101, No. 12 December 2017SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 16 Nov 2017Published: 4 Oct 2017First Look: 24 Jul 2017Accepted: 19 Jul 2017 Page: 2152 Information© 2017 The American Phytopathological SocietyCited bymgr-mir-9 implicates Meloidogyne graminicola infection in rice by targeting the effector MgPDIJournal of Integrative Agriculture, Vol. 431Potential distribution and biosecurity risks from three economically important plant‐parasitic nematodes20 October 2021 | Annals of Applied Biology, Vol. 180, No. 3Morphological characterization reveals new insights into giant cell development of Meloidogyne graminicola on rice19 February 2022 | Planta, Vol. 255, No. 3Meloidogyne graminicola's Effect on Growth Performance of Rice under Low Population Density26 February 2022 | Agronomy, Vol. 12, No. 3Meloidogyne graminicola (rice root knot nematode)CABI Compendium, Vol. CABI CompendiumRapid and Sensitive Detection of Meloidogyne graminicola in Soil Using Conventional PCR, Loop-Mediated Isothermal Amplification, and Real-Time PCR MethodsQingcong He, Dongwei Wang, Bei Tang, Jian Wang, Deyong Zhang, Yong Liu, and Feixue Cheng16 December 2020 | Plant Disease, Vol. 105, No. 2First Report of Meloidogyne graminicola on Rice in Anhui Province, ChinaYuliang Ju, Xun Wu, Genjia Tan, Deliang Peng, Jinfeng Xu, Kun Qiu, and Huiping Wu17 December 2020 | Plant Disease, Vol. 105, No. 2Identification and Characterization of a Novel Protein Disulfide Isomerase Gene (MgPDI2) from Meloidogyne graminicola16 December 2020 | International Journal of Molecular Sciences, Vol. 21, No. 24Meloidogyne graminicola protein disulfide isomerase may be a nematode effector and is involved in protection against oxidative damage16 August 2019 | Scientific Reports, Vol. 9, No. 1Oryza glumaepatula, a New Source of Resistance to Meloidogyne graminicola and Histological Characterization of Its Defense MechanismsVanessa S. Mattos, Raycenne R. Leite, Juvenil E. Cares, Ana Cristina M. M. Gomes, Antonio W. Moita, Valácia L. S. Lobo, and Regina M. D. G. Carneiro12 September 2019 | Phytopathology®, Vol. 109, No. 11First Report of Root-Knot Nematode, Meloidogyne graminicola, on Rice in Sichuan Province, Southwest ChinaJ. L. Xie, X. Xu, F. Yang, Q. Xue, Y. L. Peng, and H. L. Ji13 June 2019 | Plant Disease, Vol. 103, No. 8
First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China

Fangqi Chen,Le Wang,Ruifang Jia,Yuanyuan Zhang,Juan Sun,Zhengqiang Chen,Kejian Lin

DOI: https://doi.org/10.1094/PDIS-06-24-1212-PDN

2024-09-11

Abstract:Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.
Primal-mixed formulations for reaction-diffusion systems on deforming domains

R. Ruiz-Baier

DOI: https://doi.org/10.1016/j.jcp.2015.07.018

IF: 4.645

2015-10-15

Journal of Computational Physics

Abstract:
Molecular Characterization and Distribution of Cucumber green mottle mosaic virus in China

Yan Liu,Yanan Wang,Xifeng Wang,Guanghe Zhou

DOI: https://doi.org/10.1111/j.1439-0434.2008.01509.x

2009-08-01

Journal of Phytopathology

Abstract:Cucumber green mottle mosaic virus (CGMMV) is an emerging virus on watermelon in China. We report here the almost complete nucleotide sequence and the characterization of the genome of a Chinese isolate (CGMMV‐LN). Nucleotide sequence comparisons showed CGMMV‐LN is closely related to CGMMV‐KOM, with 99.4% identity. On the basis of the nucleotide sequence, a digoxigenin‐labelled cDNA probe CG, complementary to the replicase gene region of CGMMV was synthesized. The specificity and sensitivity of the probe was tested. The detection limit of the method was equivalent to 0.8 μg fresh tissues infected by CGMMV. Two hundreds and eighteen watermelon samples collected from different regions in China during 2006–2007 were tested by this method. The distribution pattern of CGMMV in China during these years was revealed. The virus has spread in five provinces of China so far, including Liaoning, Hebei, Guangdong, Hubei and Shandong and might be an increasing tendency, which provides important information for CGMMV control in China.

plant sciences
Detection of Cucumber mosaic virus infecting lily in China

Hong Jian,Chen Jishuang,Ye Meiqin,Huang Dongfeng

DOI: https://doi.org/10.3969/j.issn.0529-1542.2006.01.019

2006-01-01

Plant Protection

Abstract:CMV was detected from 26 out of 64 samples of lily collected from Lishui and Hangzhou,Zhejiang,China,by using enzyme-linked immunosorbent assay(ELISA).The infection rate of CMV was 40.6%.The results by dsRNA examinations suggested that the CMV infecting lily had the same dsRNA pattern with the CMV isolates obtained from tomato,but the content of dsRNA of the CMV infecting lily tissue was relatively low.The virus particles of filamentous shape were detected from the above samples infected with CMV by electron microscopy,so the co-infection rate of filamentous virus and CMV was 35.9%.Host range tests suggested that CMV obtained from lily couldn't infect Nicotiana glutinosa,N.tobacum,Cucumis sativus,Chenopodium quinoa,C.amaranticolor and other test plants from 6 families.The above results implied that CMV has commonly existed in lily and co-infected with other plant viruses.CMV infecting lily might have formed a new subgroup by host adaptation.
First Report of Cucurbit Chlorotic Yellows Virus in Cucumber, Melon, and Watermelon in China

Qinsheng Gu,Y. H. Liu,Y. H. Wang,Wei-Guo Huang-Fu,Huihui Gu,Lihui Xu,Fengming Song,Judith K. Brown

DOI: https://doi.org/10.1094/pdis-07-10-0550

IF: 4.5

2011-01-01

Plant Disease

Abstract:Systemic foliar chlorosis of melon, watermelon, and cucumber plants grown in plastichouses was first observed in Shanghai, China in 2008. By the end of October 2009, this symptom had become prevalent across 13,000 ha of plastichouses in Shanghai, Ningbo in Zhejiang Province, and Shouguang in Shandong Province. By mid-October, disease incidence ranged from 50 to 100% and losses were estimated between 10 and 20% across 100 plastichouses. Initial disease symptoms were chlorosis beginning at the base and middle portion of the older leaves followed by development of chlorotic spots on the lamina. Within 4 to 5 days, the entire leaf lamina was bright yellow and the veins remained green. The whitefly, Bemisia tabaci, was frequently observed colonizing plants in all plastichouses included in this study. Leaf samples were collected from six symptomatic cucumber, melon, and watermelon plants from individual plastichouses in Shanghai, Ningbo, and Shouguang. A pair of degenerate primers, F-5′-GGN TTA GAN TTC GGN ACN AC-3′ and R-5′-TCA AAN GTN CCN CCN CCN AA-3′, that were specific for the genera Crinivirus and Closterovirus, family Closteroviridae (2) were used to amplify a 636-bp fragment of the viral heat shock protein 70 gene (Hsp70). A PCR product of the expected size was amplified from RNA extracted with TaKaRa RNAiso Reagent (TaKaRa, Dalian, China) from symptomatic leaf samples: 3 of 3 melon, 2 of 2 watermelon, and 1 of 1 cucumber, and from 5 of 5 Bemisia tabaci adults collected from plants in five plastichouses in Shanghai, Ningbo, and Shouguang. No PCR product was obtained from RNA extracted from cucumber leaves grown in a virus-free facility at the Fruit Research Institute, Zhengzhou. PCR products were sequenced from representative plants samples and the sequences were submitted to GenBank (Nos. GU721105 to GU721107, GU72118 to GU721110, and GU721111. The six Hsp70 sequences shared 99.8 to 100% identity with Cucurbit chlorotic yellows virus (CCYV) (GenBank No. AB523789) from Japan. Using the complete CCYV sequence (1), PCR primers were designed to amplify the complete CCYV coat protein (Cp): Cp F-5′-CGCAATCAATAAGGCGGCGACC-3′ and Cp R-5′-ACTACAACCTCCCGGTGCCAACT-3′ (804 bp), minor Cp (Cpm): Cpm-F-5′-TGATGAANTGCCANGCTNTGAAA-3′ and Cpm-R5′-ACAANTGATTCACATTNACAAT-3′ (1,632 bp); and Hsp70: Hsp F-5′-TGCAACCGATGTCAGGTTCAGCG-3′ with Hsp R-5′-TGGATAATTGGTCACGACCTCCAGT-3′ (1,947 bp). One PCR amplicon was obtained for each target gene using RNA extracted from a cucumber collected in Ningbo. Three of the PCR amplicons were cloned and the DNA sequence was determined. A representative sequence for each gene was deposited in GenBank as: cp (HM581658), cpm (HM581657), and hsp70 (HM581659). The cp, cpm, and hsp70 sequences shared 99.7, 99.9, and 99.9% nt identity with the respective genes of CCYV (AB523789), whereas they shared only 62.5, 49.9, and 69.6% identity with the respective gene sequences for Cucurbit yellow stunting disorder virus (CYSDV; NC004810), suggesting the two viruses are divergent crinivirus species. Although this virus was first reported to infect cucurbits in Japan in 2009 (1), to our knowledge, this is the first report of CCYV in China. Eradication and management efforts are therefore paramount to reducing the spread of the disease. References: (1) M. Okuda et al. Phytopathology 100:560, 2010. (2) T. Tian et al. Phytopathology 86:1167, 1996.
First Report of Watermelon mosaic virus causing a Mosaic Disease on Cucumis metuliferus in China

Qiang Gao,Hai-Long Ren,Wanyu Xiao,Yan Zhang,Bo Zhou,Donglin Xu

DOI: https://doi.org/10.1094/PDIS-12-20-2744-PDN

2021-02-05

Abstract:Cucumis metuliferus, also called horned cucumber or jelly melon, is considered as a wild species in the Cucumis genus and a potential material for nematodes- or viruses-resistant breeding (Provvidenti, et al. 1977; Sigüenza et al. 2005; Chen et al. 2020). This species, originating from Africa, has been cultivated as a fruit in China in recent years. In July 2020, a mosaic disease was observed on C. metuliferus growing in five fields (approximately 0.7 hectare) in Urumqi, Xijiang, China, where more than 85~100% of the field plants exhibited moderate to severe viral disease-like leaf mosaic and/or deformation symptoms. Delayed flowering and small and/or deformed fruits on the affected plants could result in yield loss of about 50%. To identify the causal pathogen, the symptomatic leaf samples were collected from the five fields (five plants/points for each field) and their total RNAs were extracted using a commercial RNA extraction kit. The universal potyviral primers (Ha et al. 2008) and specific primers for a number of frequently-occurring, cucurbit crop-infecting viruses including Papaya ringspot virus (PRSV) (Lin et al. 2013), Cucumber mosaic virus (CMV) and Watermelon mosaic virus (WMV) were designed and used for detection by RT-PCR. The result showed that only the WMV primers (forward: 5'-AAGTGTGACCAAGCTTGGACTGCA-3' and reverse: 5'-CTCACCCATTGTGCCAAAGAACGT-3') could amplify the corresponding target fragment from the total RNA templates, and direct sequencing of the RT-PCR products and GenBank BLAST confirmed the presence of WMV (genus Potyvirus) in the collected C. metuliferus samples. To complete Koch's postulates, the infected C. metuliferus leaves were ground in the sodium phosphate buffer (0.01 M, pH 7.0) and the sap was mechanically inoculated onto 30 four-leaf-stage C. metuliferus seedlings (two leaves for each seedling were inoculated) kept in an insect-proof, temperature-controlled greenhouse at 25~28℃. Twenty-five of the inoculated plants were observed to have apparent leaf mosaic similar to the field symptoms two weeks after inoculation, and positive result was obtained in RT-PCR detection for the symptomatic leaves of inoculated plants using the WMV primers aforementioned, confirming the virus as the pathogen of C. metuliferus in Urumqi. To our knowledge, this is the first report of WMV naturally infecting C. metuliferus in China. We obtained the full-length sequence of the WMV Urumqi isolation (WMV-Urumqi) by sequencing the RT-PCR amplicons from seven pairs of primers spanning the viral genome and the 5'RACE and 3'RACE products. The complete sequence of WMV-Urumqi (GenBank accession no. MW345911) is 10046 nucleotides (nt) long and contains an open reading frame that encodes a polyprotein of 3220 amino acids (aa). WMV-Urumqi shares the highest nt identity (95.9%) and aa identity (98.0%) with the Cucurbita pepo-infecting isolation (KX664483) from Shanxi province, China. Our findings provide a better understanding of the host range and genetic diversity of WMV, and a useful reference for virus-resistant breeding involving C. metuliferus.
First report of infections with isolates of the Asian genotype of Cucumber green mottle mosaic virus in cucumber crops in Belgium

Nelia Ortega Parra,Zafeiro Zisi,Elise Vogel,Christine Vos,Inge Hanssen

DOI: https://doi.org/10.1094/PDIS-11-23-2532-PDN

2024-02-06

Abstract:In July 2019, four rows of cucumber plants (Cucumis sativus) in a commercial glasshouse in the north of Belgium showed severe mosaic, blistering and distortion of the leaves, with symptoms resembling those caused by Cucumber green mottle mosaic virus (CGMMV). CGMMV is a Tobamovirus that mainly affects cucurbit crops worldwide (Dombrovsky et al., 2017). Phylogenetic analyses in previous studies have shown two major clades, one including isolates that were initially identified in Europe and Russia (European genotype) and the second one with isolates initially identified in Asia and Israel (Asian genotype) (Dombrovsky et al., 2017; Pitman et al., 2022; Mackie et al., 2023). A symptomatic leaf sample was collected and total RNA was isolated from 100 mg of leaf tissue (Spectrum™ Plant Total RNA kit, Sigma-Aldrich). CGMMV was detected using a one-step TaqMan RT-qPCR (Hongyun et al., 2008). High-throughput sequencing (HTS) confirmed the presence of CGMMV. The sample was prepared using the Novel enrichment technique of viromes protocol (NETOVIR protocol, Conceição-Neto et al., 2015). The leaf material was homogenized, enriched for virus-like particles and the RNA was extracted (QIAamp Viral RNA mini kit, QIAGEN). The extract was randomly amplified (Whole Transcriptome Amplification kit, Sigma Aldrich), used for library preparation (Nextera XT DNA library preparation kit, Illumina) and sequenced on a NovaSeq platform. HTS data analysis was performed using Geneious Prime software (Biomatters, Auckland, New Zealand, version 2023.2). After quality filtering and trimming, 26.7M reads were obtained (132 nt mean length). In total, 20.6M reads were mapped to two genomes KP772568 and GQ411361 (considered as reference for the Asian and European genotypes respectively) with Geneious. This revealed 100% coverage of the full sequences (6422 nt) with 99.4% and 90% nucleotide identities to the reference genomes of Asian and European genotypes, respectively. Phylogenetic analyses confirmed that isolate 2019-26A-BE, with GenBank ID OR724740, relates to the Asian genotype. The HTS data were additionally processed using the ViPER pipeline (De Coninck, 2021). The raw reads were quality filtered and trimmed, (Trimmomatic) and then used to perform de novo assembly (metaSPAdes). The produced contigs were classified using DIAMOND and visualized with KronaTools. The results showed that no other virus was detected in the sample. Finally, cucumber seedlings were inoculated using the original symptomatic sample and were grown in a research glasshouse. After 3 weeks, severe CGMMV symptoms, similar to the original symptoms observed in the commercial glasshouse, were observed in the inoculated plants. Infection with CGMMV was verified via RT-qPCR, and the isolate present in the inoculated plants was confirmed to belong to the Asian genotype via RT-PCR-RFLP (Crespo et al., 2017). Later samplings of symptomatic leaves confirmed the presence of isolates belonging to the Asian genotype of CGMMV at four other commercial glasshouse locations, specializing in cucumber crop, in Belgium in 2020, 2021 and 2023 by RT-PCR-RFLP. While the Asian genotype was previously found elsewhere in Europe (Pitman et al., 2022), to our knowledge, this is the first report of infections with isolates of this genotype in glasshouse cucumber crops in Belgium. Further investigation is required to determine the spread and impact of infections with isolates of the Asian genotype in cucumber crops in Belgium.
Characterization of Maize Chlorotic Mottle Virus Associated with Maize Lethal Necrosis Disease in China

Li Xie,Jingze Zhang,Qiang Wang,Chunmei Meng,Jian Hong,Xueping Zhou

DOI: https://doi.org/10.1111/j.1439-0434.2010.01745.x

2010-01-01

Journal of Phytopathology

Abstract:A maize lethal necrosis disease was observed in Yunnan province of China. Isometric virus particles 30 nm in diameter were found in infected maize leaf tissues. Using DAS-ELISA, diseased maize plant samples reacted positively with the antiserum of Maize chlorotic mottle virus (MCMV). The complete nucleotide sequence (4436 nt) of a Yunnan isolate of MCMV was determined; it shares 97% nucleotide sequence identity with previously reported MCMV isolates. This is the first report of MCMV occurring in China.
First report of tomato leaf curl New Delhi virus infecting several cucurbit plants in China

Qinsheng Gu,Leiyan Yan,Liming Liu,Weihong Bao,Hui Fang,Jinhua Xu,Jufen Li,Baoshan Kang,Huijie Wu,Kang Wang,Xiaorong Tao,Bin Peng

DOI: https://doi.org/10.1094/PDIS-01-23-0180-PDN

2023-04-20

Abstract:In autumn 2022, a novel and devastating viral disease affecting cucurbits emerged in Ningbo (Zhejiang province), Haimen (Jiangsu province), and Shanghai, China, causing an approximate 650-hectare infestation and resulting in nearly US$15 million in economic losses. The incidence rates of infection reached up to 72.5% on muskmelon (Cucumis melo L. ssp melo), oriental melon (Cucumis melo L. var. agrestis), pumpkin (Cucurbita moschata), luffa (Luffa acutangula), and squash (Cucurbita pepo), and were highly associated with the presence of whitefly (Bemisia tabaci). Infected plants exhibited symptoms such as dwarf stunting, reduced leaf size, leaf chlorotic patches, malformation, fruit deformation, leaf downward rolling, and yellowing (Figure 1). To identify the pathogen, forty cucurbit leaf samples were collected from Haimen (18), Ningbo (19), and Shanghai (3) and tested for cucurbits chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and Begomovirus using RT-PCR or PCR. All samples tested negative for CCYV and CYSDV using species-specific primers; however, 29 out of 40 samples tested positive (see Supplementary Table 1) for Begomovirus using the degenerate primer pairs PA/PB (Deng et al. 1994). PCR products from seven samples, representing different regions and hosts, underwent Sanger sequencing. The nucleotide sequences of these products showed 98.2-99% identity to tomato leaf curl New Delhi virus (ToLCNDV) by BLASTn. Subsequently, the 29 positive cucurbit samples were confirmed using ToLCNDV-specific primer pairs NDVAF/NDVAR and NDVBF/NDVBR (Jyothsna et al. 2013) for DNA-A and DNA-B, respectively. The DNA-A and DNA-B genome sequences of ToLCNDV isolates from Haimen (Haimen4), Ningbo (Ningbo6), and Shanghai (Shanghai1) were obtained using the primer pairs NDVAF/NDVAR, A1961F/A2645R (covering complete DNA-A sequences), NDVBF/NDVBR, and B1613F/B2579R (covering complete DNA-B sequences，see Supplementary Table 2). No amplicon was produced with primer pairs UNA101/UNA102 and beta01/beta02 (Supplementary Table 2) for detecting Alphasatellite and Betasatellite DNAs, respectively. The complete DNA-A genome sequences (2739 bp) of Haimen 4 (accession no. OP585369), Ningbo 6 (accession no. OP585370), and Shanghai 1 (accession no. OP683993) isolates exhibited 99.5-99.6% nucleotide identity to each other, and their highest nucleotide sequence identity (99.3-99.4%) was shared with the DNA-A of ToLCNDV-Zhejiang isolate (accession no. OP356207) from tomato in Zhejiang Province, China. The complete nucleotide sequences (2693 nt) of DNA-B for Haimen 4 (accession no. OP683995), Ningbo 6 (accession no. OP683996), and Shanghai 1 (accession no. OP683994) isolates showed 99.0-99.1% identity to each other, and their highest nucleotide sequence identity (~99.1%) was shared with the DNA-B of ToLCNDV-Zhejiang isolate (accession no. OP356208).All ToLCNDV isolates from mainland China, including the Zhejiang isolate and the three isolates in this study, shared 98.3-98.7% nucleotide sequence identity and 98.2-98.4% with the DNA-A genome of the severe isolate (accession no. HM159454) from tomato in New Delhi, India, and the DNA-B genome of the India:Delhi:Cucumis:2012 isolate from cucumber in New Delhi, India, respectively. However, the genome sequence identities between mainland and Taiwan isolates (accession nos. GU180095 and GU180096) were below 93%, suggesting that mainland China isolates of ToLCNDV are more closely related to the India isolate than to the Taiwan isolate.To fulfill Koch's postulates, infectious clones of the Haimen 4 isolate were constructed and agroinfiltrated into muskmelon, oriental melon, pumpkin, luffa, and squash plants. In brief, two plasmids, containing 1.56-mer DNA-A and 1.4-mer DNA-B genome sequences, were constructed using enzyme digestion and ligation, transformed into Agrobacterium tumefaciens strain GV3101, respectively, and then co-agroinfiltrated into cucurbit plants. Initial symptoms appeared in the new leaves at 7 days post-inoculation (DPI), followed by severe leaf curling, dwarfing, stunting, reduced leaf size, and chlorotic leaf patches at 18 DPI. The presence of DNA-A and DNA-B of ToLCNDV in inoculated plants was confirmed by PCR using primer pairs A1961F/A2645R and B1613F/B2579R, respectively. Collectively, the pathogen of this emerging disease has been identified as ToLCNDV. ToLCNDV was first reported on tomato in India and is now the most predominant and economically significant disease affecting cucurbit and solanaceous crops in Southeast and East Asia, the Middle East, and the Mediterranean Basin (Moriones et al. 2017). In China, ToLCNDV was initially reported on oriental melon in Taiwan (Chang et al. 2010) and subsequently on tomato (Lycopersicon esculentum) in Zhejiang province (Li et al. 2022). To the best of our knowledge, this is the first report of ToLCNDV infecting muskmelon, pumpkin, luffa, and squash in China. Further investigations on the epidemiology of this viral disease in China are needed.
First Detection and Complete Genome of Soybean Chlorotic Mottle Virus Naturally Infecting Soybean in China by Deep Sequencing

Hu Qian-qian,Liu Xue-jian,Han Xue-dong,Liu Yong,Jiang Jun-xi,Xie Yan

DOI: https://doi.org/10.1016/s2095-3119(19)62665-1

IF: 4.8

2019-01-01

Journal of Integrative Agriculture

Abstract:Soybean chlorotic mottle virus (SbCMV) was first detected from soybean plants in Jiangxi Province of China by high throughput sequencing and was confirmed by PCR. The complete nucleotide sequence of NC113 was determined to be 8 210 nucleotides, and shared the highest similarity (91.7%) with sequences of SbCMV that was only reported in Japan. It encodes nine putative open reading frames (ORFs Ia, Ib and II–VIII), and contains a large intergenic region located at nucleotide 5 976–6 512 between ORFs VI and VII. Sequence analysis and phylogenetic tree indicated that NC113 is an isolate of SbCMV, and is more related to the soymoviruses Blueberry red ringspot virus (BRRSV), Peanut chlorotic streak virus (PCSV) and Cestrum yellow leaf curling virus (CmYLCV) than to other representative members in the Caulimoviridae family. Field survey of 472 legume plants from Jiangxi and Zhejiang provinces showed SbCMV was only detected from soybean in Nanchang City with a low incidence rate. This is the first report of Soybean chlorotic mottle virus identified in China.
Cotton leaf curl Multan virus newly reported to be associated with cotton leaf curl disease in China

J. H. Cai,K. Xie,L. Lin,B. X. Qin,B. S. Chen,J. R. Meng,Y. L. Liu

DOI: https://doi.org/10.1111/j.1365-3059.2010.02266.x

2010-01-01

Plant Pathology

Abstract:Cotton (genus Gossypium, family Malvaceae) is one of the most important crops in China. In October 2008 and July 2009, some cotton plants were found to develop upward leaf curl symptoms accompanied by thickening and often thick dark greening of leaf veins, leafy enations and stunting in a field of the suburb of Nanning city, Guangxi, China. Leaf samples of three individual cotton plants exhibiting leaf curl symptoms were collected in 2009 and tested for the presence of geminiviruses. Using the universal begomovirus-specific primers A and B (Liu et al., 1998) which amplify the partial intergenic region and V2 gene, all three samples gave approximately 500 bp PCR products which were cloned and sequenced. Their sequences were almost identical. Full-length DNA-A of isolate GX1 was amplified by PCR using additional primers designed on the basis of the determined sequences and cloned. The complete DNA-A sequence of isolate GX1 (CLCuMV-[CN:GX1:09]) was determined to be 2738 nucleotides (GenBank Accession No. GQ924756). A comparison with other begomoviruses showed that DNA-A of isolate GX1 has more than 99·7% nucleotide sequence identity to Cotton leaf curl Multan virus (CLCuMV) isolates G6 (EF465535) and Okra06 (FJ770370) and shares 93·7 to 95·6% nucleotide sequence identity to other CLCuMV isolates CLCuMV (GenomeNet NC_004607), CLCuMV-26 (AJ002458), CLCuMV-62 (AJ002447) and CLCuMV-Ok (AJ002459). The previously characterized CLCuMV isolates have been shown to be associated with DNA β molecules (Briddon et al., 2001; Mao et al., 2008). To test whether a satellite molecule was associated with this isolate, PCR was performed with a pair of DNA β conserved primers (Briddon et al., 2002). About 1·3 kb PCR products were obtained from all three samples, cloned and sequenced, revealing that the sequences from all samples were almost identical. Full-length DNA β of isolate GX1 was amplified using additional primers designed on the basis of the determined sequences and cloned. The 1346 bp full-length sequence of DNA β of isolate GX1 (CLCuMB-[CN:GX1:09]) was submitted to GenBank (GQ906588). A comparison with other satellite molecules showed that the DNA β of isolate GX1 has more than 99·4% nucleotide sequence identity to CLCuMV satellite DNA β of isolates G6 (EF465536) and Okra06 (FJ770371), and 91·4 and 92·4% nucleotide sequence identity to CLCuMB-[PK:Fai1:96] (AJ298903) and CLCuMB-[IN:Bha:05] (DQ191161), respectively. Based on the symptoms and sequence information, the cotton leaf curl disease in China is associated with CLuCMV and is the first report of a virus associated with cotton disease in China. This work was supported by the National Natural Science Foundation of China (Grant No. 30725002 to Y. L. Liu) and Science and technology Development Foundation of Guangxi Academy of Agricultural Sciences (Grant No. 200902 Z to J. H. Cai).
First Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium Candidum in China

Zhongyang Sun,Y. H. Zhang,Qian Xu,Zhong Chen,Li Xie,Bizeng Mao

DOI: https://doi.org/10.1094/pdis-07-18-1165-pdn

IF: 4.5

2019-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 103, No. 5First Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium candidum in China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium candidum in ChinaZ. Y. Sun, Y. H. Zhang, Q. Q. Xu, Z. X. Chen, L. Xie, and B. Z. MaoZ. Y. Sunhttp://orcid.org/0000-0003-4453-0284Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this author, Y. H. ZhangInstitute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this author, Q. Q. XuInstitute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this author, Z. X. ChenInstitute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this author, L. XieAnalysis Center of Agrobiology and Environmental Science, Zhejiang University, Hangzhou 310058, ChinaSearch for more papers by this author, and B. Z. Mao†Corresponding author: B. Z. Mao; E-mail: E-mail Address: [email protected]Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this authorAffiliationsAuthors and Affiliations Z. Y. Sun1 Y. H. Zhang1 Q. Q. Xu1 Z. X. Chen1 L. Xie2 B. Z. Mao1 † 1Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and 2Analysis Center of Agrobiology and Environmental Science, Zhejiang University, Hangzhou 310058, China Published Online:26 Feb 2019https://doi.org/10.1094/PDIS-07-18-1165-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Dendrobium candidum is one of the traditional medicinal plants of China and has been recorded in the Chinese Pharmacopoeia (2005 edition) as one of the original materials of “Shi Hu” (Li et al. 2008). Its stems are made as medicine for antipyretic, eyes-benefiting, antitumor, antiaging, and tonic purposes. In May 2018, chlorotic blotches, mosaic, and mottle symptoms were observed on 3-year-old seedlings in the greenhouse in Menghai City, Yunnan Province, China. After negative staining of samples with phosphotungstic acid, flexuous filamentous virus particles of 600 to 900 nm in length were observed using a transmission electron microscope (TEM). Bundles of flexuous filamentous particles and cylindrical inclusion bodies typical of potyviruses were observed in the cells of D. candidum under TEM after ultrathin sectioning. Leaf samples were collected from 18 symptomatic plants and tested by double antibody sandwich ELISA (Takara) with antisera against sweet potato feathery mottle virus (SPFMV), zucchini yellow mosaic virus, turnip mosaic virus, and potato virus Y. Eight samples reacted with the SPFMV antiserum, but none of the 18 samples reacted with the other antisera. Total nucleic acids were extracted from six symptomatic leaf samples using Fruit-mate for RNA Purification (Takara) and TRIzol, and they were then tested with reverse transcription polymerase chain reaction (PCR) using a pair of specific primers, SPFMV-F and SPFMV-R (Kwak et al. 2014). A single band of 356 bp was observed when the PCR products were analyzed on a 1% agarose gel. The PCR product was purified using a DNA Gel Extraction Kit (Tsingke, China), cloned in pGEM-T Easy Vector (Promega), and sequenced in both directions. A consensus sequence was obtained from six clones and submitted to GenBank (MH508094). This isolate shared 98 to 99% nucleotide identity with corresponding SPFMV sequences deposited in GenBank and showed the highest nucleotide sequence identity (99%) with the Korean isolate of SPFMV from sweet potato (KP115608). This is the first report of SPFMV naturally infecting D. candidum in China; therefore, effective management strategies should be adopted to prevent introduction of this virus in D. candidum growing regions.References:Kwak, H.-R., et al. 2014. Plant Pathol. J. 30:416. https://doi.org/10.5423/PPJ.OA.04.2014.0029 Crossref, ISI, Google ScholarLi, Y., et al. 2008. Chem. Pharm. Bull. (Tokyo) 56:1477. https://doi.org/10.1248/cpb.56.1477 Crossref, ISI, Google ScholarZ. Y. Sun and Y. H. Zhang contributed equally to this article.Funding: This research was supported by the key research and development projects of Zhejiang Province in 2018 (no. 2018C02034) and Zhejiang province agricultural Chinese medicine new variety breeding major science and technology special project (no. 2016C02058-3).DetailsFiguresLiterature CitedRelated Vol. 103, No. 5 May 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionTomato leaves infected with Tomato chlorotic dwarf viroid (Olmedo-Velarde, Roy, Belanger, Watanabe, Hamasaki, Mavrodieva, Nakhla, and Melzer). Photo credit: M. J. Melzer. Spinach plants with downy mildew symptoms caused by Peronospora effusa (Kandel, Mou, Shishkoff, Shi, Subbarao, and Klosterman). Photo credit: S. L. Kandel. Metrics Article History Issue Date: 8 May 2019Published: 26 Feb 2019First Look: 15 Nov 2018Accepted: 12 Nov 2018 Pages: 1047-1047 Information© 2019 The American Phytopathological SocietyFundingkey research and development projects of Zhejiang Province in 2018Grant/Award Number: 2018C02034Zhejiang province agricultural Chinese medicine new variety breeding major science and technology special projectGrant/Award Number: 2016C02058-3Cited byDevelopment of a dual RT-RPA detection for Sweet potato feathery mottle virus and Sweet potato chlorotic stunt virusMolecular and Cellular Probes, Vol. 65Sweet potato feathery mottle virus (internal cork disease of sweet potato)CABI Compendium, Vol. CABI CompendiumDissipation, occurrence, and risk assessment of 12 pesticides in Dendrobium officinale Kimura et MigoEcotoxicology and Environmental Safety, Vol. 222A rapid sap‐direct reverse transcription‐polymerase chain reaction method for detection of dendrobium viroid in Dendrobium plants19 May 2021 | Letters in Applied Microbiology, Vol. 73, No. 1Dendrobium viroid, a new monocot-infecting apscaviroidVirus Research, Vol. 282
President-Elect's Message: The Support of Dental Research

H. Fullmer

DOI: https://doi.org/10.1177/002203457605500408011

1976-04-01

Abstract:

Acid-base indicators in N,N-dimethylformamide: chromatic parameters of transition ranges.

Genetic Variation and Population Structure of Cucumber Green Mottle Mosaic Virus.

Molecular Characterization and Pathogenicity of a Novel Monopartite Geminivirus Infecting Tobacco in China

First Report of Cucumber Green Mottle Mosaic Virus Infecting Zucchini (Cucurbita pepo) and Wax Gourd (Benincasa hispida) in China

Impact of CLIA 88 on the clinical microbiology laboratory.

Characterization Of A Novel Polerovirus Infecting Maize In China

First Report of Pepper Veinal Mottle Virus Infecting Pepper in Mainland China

First Report of Root-knot Nematode, Meloidogyne Graminicola, on Rice in Zhejiang, Eastern China

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China

Primal-mixed formulations for reaction-diffusion systems on deforming domains

Molecular Characterization and Distribution of Cucumber green mottle mosaic virus in China

Detection of Cucumber mosaic virus infecting lily in China

First Report of Cucurbit Chlorotic Yellows Virus in Cucumber, Melon, and Watermelon in China

First Report of Watermelon mosaic virus causing a Mosaic Disease on Cucumis metuliferus in China

First report of infections with isolates of the Asian genotype of Cucumber green mottle mosaic virus in cucumber crops in Belgium

Characterization of Maize Chlorotic Mottle Virus Associated with Maize Lethal Necrosis Disease in China

First report of tomato leaf curl New Delhi virus infecting several cucurbit plants in China

First Detection and Complete Genome of Soybean Chlorotic Mottle Virus Naturally Infecting Soybean in China by Deep Sequencing

Cotton leaf curl Multan virus newly reported to be associated with cotton leaf curl disease in China

First Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium Candidum in China

President-Elect's Message: The Support of Dental Research