Abstract:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Spectrum of WAS gene mutations in Vietnamese patients with Wiskott–Aldrich syndrome

Wiskott-Aldrich syndrome: A new synonym mutation in the WAS gene

A Novel Splicing Mutation Leading to Wiskott-Aldrich Syndrome from a Family

A novel WT1 gene mutation in a chinese girl with denys-drash syndrome

Wilson Disease: Identification of Two Novel Mutations and Clinical Correlation in Eastern Chinese Patients

High Genetic Heterogeneity in Chinese Patients With Waardenburg Syndrome Revealed by Next-Generation Sequencing

Pathogenic/likely pathogenic mutations identified in Vietnamese children diagnosed with autism spectrum disorder using high-resolution SNP genotyping platform

A Genetic Mutation Study in a Pedigree with Type II Waardenburg Syndrome

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis

A Novel Mutation of PAX3 in a Chinese Family with Waardenburg Syndrome.

[Genetic Analysis of a Family of Van Der Woude Syndrome].

Spectrum and Classification of ATP7B Variants in a Large Cohort of Chinese Patients with Wilson's Disease Guides Genetic Diagnosis

Wiskott–Aldrich syndrome protein expression in female WAS carriers: A flow cytometry study from North India

SOX10 gene mutation screening in one Chinese family with Waardenburg syndrome type 2

Wiskott-Aldrich Syndrome: A Report of a Rare X-Linked Disorder

Spectrum and Clinical Features of Gene Mutations in Chinese Pediatric Acute Lymphoblastic Leukemia

Polymorphisms and Expression of the Wnt8a Gene in Hirschsprung'S Disease

Spectrum of ATP7B mutations and genotype-phenotype correlation in large-scale Chinese patients with Wilson Disease

What WAS disease risk then versus now?

Genotype-phenotype characteristics of Vietnamese patients diagnosed with Charcot-Marie-Tooth disease

Identification of novel EIF2B mutations in Chinese patients with vanishing white matter disease