Abstract:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

A Novel Mutation of PAX3 in a Chinese Family with Waardenburg Syndrome.

Gene Mutation Analysis in a Chinese Pedigree with Autosomal Dominant Waardenburg Syndrome

High Genetic Heterogeneity in Chinese Patients With Waardenburg Syndrome Revealed by Next-Generation Sequencing

SOX10 gene mutation screening in one Chinese family with Waardenburg syndrome type 2

A Genetic Mutation Study in a Pedigree with Type II Waardenburg Syndrome

Identification of A Novel Frameshift Mutation in Pitx2 Gene in A Chinese Family with Axenfeld-Rieger Syndrome

A novel WT1 gene mutation in a chinese girl with denys-drash syndrome

Double heterozygous mutations of MITF and PAX3 result in Waardenburg syndrome with increased penetrance in pigmentary defects

Clinical and genetic analysis of a Chinese family with Walker-Warburg syndrome

The Novel Compound Heterozygous Mutations, V434del and W666X, in WFS1 Gene Causing the Wolfram Syndrome in a Chinese Family

Identification Of One Novel Mutant Pax6 Allele In Chinese Congenital Aniridia And Cataract Family

A novel nonsense mutation of ZEB2 gene in a Chinese patient with Mowat-Wilson syndrome

A Novel Mutation in the MITF May Be Digenic with GJB2 Mutations in a Large Chinese Family of Waardenburg Syndrome Type II

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis

Case report: Exotropia in waardenburg syndrome with novel variations

Identification of of a <i>PAX2</i> mutation from maternal mosaicism causes recurrent renal disorder in siblings

A Novel PAX3 Variant in a Chinese Pedigree with Nonsyndromic Cleft Lip With or Without Palate

Case report: Heterogeneous mutations of SOX10 gene in a Chinese infant with Waardenburg syndrome type 4C

Two novel mutations of WFS1 gene in a Chinese family with Wolfram syndrome

[Genetic Analysis of a Family of Van Der Woude Syndrome].

Quantitative assessment of low-level parental mosaicism of SNVs and CNVs in Waardenburg syndrome