Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Correction: Aptamer AS1411 interacts with the KRAS promoter/hnRNP A1 complex and shows increased potency against drug-resistant lung cancer

Aptamer AS1411 interacts with the KRAS promoter/hnRNP A1 complex and shows increased potency against drug-resistant lung cancer (Mar, 10.1039/D3MD00752a, 2024)

Aptamer AS411 interacts with the KRAS promoter/hnRNP A1 complex and shows increased potency against drug-resistant lung cancer

Correction To: Targeted Therapy for Cisplatin‐resistant Lung Cancer Via Aptamer‐guided Nano‐zinc Carriers Containing USP14 Sirna

Correction: The improved targeting of an aspirin prodrug albumin-based nanosystem for visualizing and inhibiting lung metastasis of breast cancer

Corrigendum: Diplatin, a Novel and Low-Toxicity Anti-Lung Cancer Platinum Complex, Activation of Cell Death in Tumors Via a ROS/JNK/p53-Dependent Pathway, and a Low Rate of Acquired Treatment Resistance

Correction To: Therapeutic Efficacy, Pharmacokinetic Profiles, and Toxicological Activities of Humanized Antibody-Drug Conjugate Zt/g4-MMAE Targeting RON Receptor Tyrosine Kinase for Cancer Therapy

Erratum To: Biological Evaluation of Antibody-Maytansinoid Conjugates As a Strategy of RON Targeted Drug Delivery for Treatment of Non-Small Cell Lung Cancer

Author Correction: NRF2-GPX4/SOD2 axis imparts resistance to EGFR-tyrosine kinase inhibitors in non-small-cell lung cancer cells

Corrigendum: Proteasome inhibitor YSY01A abrogates constitutive STAT3 signaling via down-regulation of Gp130 and JAK2 in human A549 lung cancer cells.

Correction: Tobramycin-mediated self-assembly of DNA nanostructures for targeted treatment of Pseudomonas aeruginosa -infected lung inflammation

Correction to: Therapeutic efficacy of the novel SHP2 degrader SHP2-D26, alone or in combination, against lung cancer is associated with modulation of p70S6K/S6, Bim and Mcl-1

Publisher Correction: Precise targeting of POLR2A as a therapeutic strategy for human triple negative breast cancer (Nature Nanotechnology, (2019), 14, 4, (388-397), 10.1038/s41565-019-0381-6)

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

Corrigendum: Regulation of microrna-497-targeting AKT2 influences tumor growth and chemoresistance to cisplatin in lung cancer

Corrigendum: A novel LncRNA, AC091729.7 promotes sinonasal squamous cell carcinomas proliferation and invasion through binding SRSF2

Preparation of AS1411 Aptamer Modified Mn-MoS2 QDs for Targeted MR Imaging and Fluorescence Labelling of Renal Cell Carcinoma [Corrigendum]

[Corrigendum] microRNA‐181a‐5p functions as an oncogene in renal cell carcinoma

Corrigendum to “Transferrin-Guided Intelligent Nanovesicles Augment the Targetability and Potency of Clinical PLK1 Inhibitor to Acute Myeloid Leukemia” [bioact. Mater. 21 (march 2023) 499–510]

[Corrigendum] Effects of miR‑340 overexpression and knockdown on the proliferation and metastasis of NSCLC cell lines

Correction: Publisher Correction: Simultaneous Overactivation of Wnt/β-catenin and TGFβ Signalling by Mir-128-3p Confers Chemoresistance-Associated Metastasis in NSCLC