Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Correction To: Mir199a-3P Regulates P53 by Targeting CABLES1 in Mouse Cardiac C-Kit+ Cells to Promote Proliferation and Inhibit Apoptosis Through a Negative Feedback Loop

Mir199a-3P Regulates P53 by Targeting CABLES1 in Mouse Cardiac C-Kit + Cells to Promote Proliferation and Inhibit Apoptosis Through a Negative Feedback Loop

Mir-92A is a Critical Regulator of the Apoptosis Pathway in Glioblastoma with Inverse Expression of BCL2L11

Correction: PRMT5 Circular RNA Promotes Metastasis of Urothelial Carcinoma of the Bladder Through Sponging Mir-30C to Induce Epithelial–Mesenchymal Transition

Author Correction: MiR218 Modulates Wnt Signaling in Mouse Cardiac Stem Cells by Promoting Proliferation and Inhibiting Differentiation through a Positive Feedback Loop

Correction To: MiRNA-195-5p Functions As a Tumor Suppressor and a Predictive of Poor Prognosis in Non-small Cell Lung Cancer by Directly Targeting CIAPIN1

Author Correction: PBX3 is Targeted by Multiple Mirnas and is Essential for Liver Tumour-Initiating Cells

Erratum: Artemin is estrogen regulated and mediates antiestrogen resistance in mammary carcinoma

Correction To: MiR-139-5p Inhibits Migration and Invasion of Colorectal Cancer by Downregulating AMFR and NOTCH1

Correction: YAP Suppresses Lung Squamous Cell Carcinoma Progression Via Deregulation of the DNp63–GPX2 Axis and ROS Accumulation

Mir-182-5p Promotes Hepatocellular Carcinoma Progression by Repressing FOXO3a.

[Corrigendum] Upregulation of centromere protein M promotes tumorigenesis: A potential predictive target for cancer in humans

[Corrigendum] HepaCAM inhibits cell proliferation and invasion in prostate cancer by suppressing nuclear translocation of the androgen receptor via its cytoplasmic domain

Corrigendum: Inhibition of TGF-β/Smad3 Signaling Disrupts Cardiomyocyte Cell Cycle Progression and Epithelial–Mesenchymal Transition-Like Response During Ventricle Regeneration

Correction To: RIP1 Protects Melanoma Cells from Apoptosis Induced by BRAF/MEK Inhibitors.

[Corrigendum] miR‐135 regulated breast cancer proliferation and epithelial‐mesenchymal transition acts by the Wnt/β‐catenin signaling pathway

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

Erratum: miR-181a, delivered by hypoxic PTC-secreted exosomes, inhibits DACT2 by downregulating MLL3, leading to YAP-VEGF-mediated angiogenesis

[Retracted] miR‐660‐5p is associated with cell migration, invasion, proliferation and apoptosis in renal cell carcinoma

Correction: Loss of EGFR Signaling-Regulated Mir-203 Promotes Prostate Cancer Bone Metastasis and Tyrosine Kinase Inhibitors Resistance

Correction: Transcriptional Effects of E3 Ligase Atrogin-1/MAFbx on Apoptosis, Hypertrophy and Inflammation in Neonatal Rat Cardiomyocytes.