First Report of <i>Pseudomonas mosselii</i> Causing White Blotch Disease in <i>Pleurotus pulmonarius</i> in China
Zaixing Huang,Zhiyuan Wei,Han Chen,Yinyin Liu,Yiliang Liu,Bin Liu
DOI: https://doi.org/10.1094/pdis-01-22-0201-pdn
IF: 4.5
2023-01-01
Plant Disease
Abstract:HomePlant DiseaseVol. 107, No. 2First Report of Pseudomonas mosselii Causing White Blotch Disease in Pleurotus pulmonarius in China PreviousNext DISEASE NOTE OPENOpen Access licenseFirst Report of Pseudomonas mosselii Causing White Blotch Disease in Pleurotus pulmonarius in ChinaZaixing Huang, Zhiyuan Wei, Han Chen, Yinyin Liu, Yiliang Liu, and Bin LiuZaixing Huanghttps://orcid.org/0000-0001-7771-8254Institute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, ChinaSearch for more papers by this author, Zhiyuan WeiInstitute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, ChinaSearch for more papers by this author, Han ChenInstitute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, ChinaSearch for more papers by this author, Yinyin LiuInstitute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, ChinaSearch for more papers by this author, Yiliang LiuInstitute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, ChinaSearch for more papers by this author, and Bin Liu†Corresponding author: B. Liu; E-mail Address: [email protected]Institute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, ChinaSearch for more papers by this authorAffiliationsAuthors and Affiliations Zaixing Huang Zhiyuan Wei Han Chen Yinyin Liu Yiliang Liu Bin Liu † Institute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, China Published Online:10 Feb 2023https://doi.org/10.1094/PDIS-01-22-0201-PDNAboutSectionsView articlePDFSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat View articlePleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7 to 1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen was isolated from infected cap tissues using a dilution plate technique: sections of tissue (∼5 × 5 × 5 mm) with white blotch were rinsed three times in sterile deionized water (SDW) and mashed in sterile 2-ml Eppendorf tubes, 1,000 µl of sterile water was added, and the suspension was diluted into eight concentrations (10−1 to 10−8). From each concentration, 120 µl of suspension was spread on Luria Bertani (LB) medium and incubated for 24 h at 28°C. Both 10−5 and 10−6 suspensions had single colonies; the dominant single colonies were picked and purified two to three times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth, and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King’s B medium. Amplified 16S rDNA (1,396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r exhibited 100% identity to Pseudomonas (Ps.) mosselii. Partial sequences of the rpoB (1,173 bp; OM202622), rpoD (734 bp; ON469579), gyrB (1,383 bp; OM202621), and recA (887 bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27 (Tayeb et al. 2005), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018), and recA-F (5′–3′ ACGACAACAAGAAGCGCGCCTT)/recA-R (5′–3′ CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, and exhibited 99 to 100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates clustered with Ps. mosselii. Biochemical tests for isolates were performed via bacterial microbiochemical reaction tubes (Hangzhou Microbial Reagent Co.), and results showed the same biochemical characteristics as Ps. mosselii (positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine, and gelatin; negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction, and malonate) (Dabboussi et al. 2002; Soto-Rodriguez et al. 2013). Isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. The isolate was incubated in LB broth at 28°C and 160 rpm for 24 h, and bacterial cells were collected by centrifugation at 4,000 rpm for 10 min. The collected cells were resuspended in SDW. For pathogenicity tests, 30 µl of bacterial suspension (∼1 × 109 CFU/ml) was added to the surface of the cap (3 to 4 cm) of young P. pulmonarius. SDW was added as a negative control. All treatments were incubated at 22°C and 80 to 85% humidity. The experiment was repeated three times with three bags each time. Twelve hours later, white blotches were visible on all parts of the inoculated mushroom. Disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initial isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB, and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It was shown to be pathogenic to Oreochromis niloticus and humans (Huang et al. 2018; Leneveu-Jenvrin et al. 2013; Peña et al. 2019; Soto-Rodriguez et al. 2013). This is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects its commercial value and requires attention of the mushroom industry.The author(s) declare no conflict of interest.References:Agaras, B. C., et al. 2018. Methods Protoc. 1:24. Crossref, Google ScholarDabboussi, F., et al. 2002. Int. J. Syst. Evol. Microbiol. 52:363. https://doi.org/10.1099/00207713-52-2-363 Crossref, ISI, Google ScholarHuang, C. R., et al. 2018. Kaohsiung J. Med. Sci. 34:49. https://doi.org/10.1016/j.kjms.2017.08.007 Crossref, ISI, Google ScholarLeneveu-Jenvrin, C., et al. 2013. BMC Microbiol. 13:123. https://doi.org/10.1186/1471-2180-13-123 Crossref, Google ScholarMulet, M., et al. 2009. Mol. Cell. Probes 23:140. https://doi.org/10.1016/j.mcp.2009.02.001 Crossref, ISI, Google ScholarPeña, A., et al. 2019. Access Microbiol. 1:e000067. https://doi.org/10.1099/acmi.0.000067 Crossref, Google ScholarSoto-Rodriguez, S. A., et al. 2013. J. Appl. Microbiol. 115:654. https://doi.org/10.1111/jam.12280 Crossref, ISI, Google ScholarTayeb, L. A., et al. 2005. Res. Microbiol. 156:763. https://doi.org/10.1016/j.resmic.2005.02.009 Crossref, ISI, Google ScholarFunding: This research was supported by Guangxi Key R&D Program Project (AB18221047).The author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Vol. 107, No. 2 February 2023SubscribeISSN:0191-2917e-ISSN:1943-7692 Download Metrics Article History Issue Date: 28 Feb 2023Published: 10 Feb 2023First Look: 13 Jul 2022Accepted: 11 Jul 2022 Page: 549 Information© 2023 The American Phytopathological SocietyFundingGuangxi Key R&D Program ProjectGrant/Award Number: AB18221047Keywordsbacterial diseasesPleurotus pulmonariusPseudomonas mosseliiThe author(s) declare no conflict of interest.PDF download