Abstract:HomePlant DiseaseVol. 107, No. 2First Report of Pseudomonas mosselii Causing White Blotch Disease in Pleurotus pulmonarius in China PreviousNext DISEASE NOTE OPENOpen Access licenseFirst Report of Pseudomonas mosselii Causing White Blotch Disease in Pleurotus pulmonarius in ChinaZaixing Huang, Zhiyuan Wei, Han Chen, Yinyin Liu, Yiliang Liu, and Bin LiuZaixing Huanghttps://orcid.org/0000-0001-7771-8254Institute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, ChinaSearch for more papers by this author, Zhiyuan WeiInstitute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, ChinaSearch for more papers by this author, Han ChenInstitute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, ChinaSearch for more papers by this author, Yinyin LiuInstitute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, ChinaSearch for more papers by this author, Yiliang LiuInstitute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, ChinaSearch for more papers by this author, and Bin Liu†Corresponding author: B. Liu; E-mail Address: [email protected]Institute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, ChinaSearch for more papers by this authorAffiliationsAuthors and Affiliations Zaixing Huang Zhiyuan Wei Han Chen Yinyin Liu Yiliang Liu Bin Liu † Institute of Applied Microbiology, College of Agriculture, Guangxi University, Nanning 530005, China Published Online:10 Feb 2023https://doi.org/10.1094/PDIS-01-22-0201-PDNAboutSectionsView articlePDFSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat View articlePleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7 to 1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen was isolated from infected cap tissues using a dilution plate technique: sections of tissue (∼5 × 5 × 5 mm) with white blotch were rinsed three times in sterile deionized water (SDW) and mashed in sterile 2-ml Eppendorf tubes, 1,000 µl of sterile water was added, and the suspension was diluted into eight concentrations (10−1 to 10−8). From each concentration, 120 µl of suspension was spread on Luria Bertani (LB) medium and incubated for 24 h at 28°C. Both 10−5 and 10−6 suspensions had single colonies; the dominant single colonies were picked and purified two to three times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth, and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King’s B medium. Amplified 16S rDNA (1,396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r exhibited 100% identity to Pseudomonas (Ps.) mosselii. Partial sequences of the rpoB (1,173 bp; OM202622), rpoD (734 bp; ON469579), gyrB (1,383 bp; OM202621), and recA (887 bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27 (Tayeb et al. 2005), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018), and recA-F (5′–3′ ACGACAACAAGAAGCGCGCCTT)/recA-R (5′–3′ CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, and exhibited 99 to 100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates clustered with Ps. mosselii. Biochemical tests for isolates were performed via bacterial microbiochemical reaction tubes (Hangzhou Microbial Reagent Co.), and results showed the same biochemical characteristics as Ps. mosselii (positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine, and gelatin; negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction, and malonate) (Dabboussi et al. 2002; Soto-Rodriguez et al. 2013). Isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. The isolate was incubated in LB broth at 28°C and 160 rpm for 24 h, and bacterial cells were collected by centrifugation at 4,000 rpm for 10 min. The collected cells were resuspended in SDW. For pathogenicity tests, 30 µl of bacterial suspension (∼1 × 109 CFU/ml) was added to the surface of the cap (3 to 4 cm) of young P. pulmonarius. SDW was added as a negative control. All treatments were incubated at 22°C and 80 to 85% humidity. The experiment was repeated three times with three bags each time. Twelve hours later, white blotches were visible on all parts of the inoculated mushroom. Disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initial isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB, and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It was shown to be pathogenic to Oreochromis niloticus and humans (Huang et al. 2018; Leneveu-Jenvrin et al. 2013; Peña et al. 2019; Soto-Rodriguez et al. 2013). This is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects its commercial value and requires attention of the mushroom industry.The author(s) declare no conflict of interest.References:Agaras, B. C., et al. 2018. Methods Protoc. 1:24. Crossref, Google ScholarDabboussi, F., et al. 2002. Int. J. Syst. Evol. Microbiol. 52:363. https://doi.org/10.1099/00207713-52-2-363 Crossref, ISI, Google ScholarHuang, C. R., et al. 2018. Kaohsiung J. Med. Sci. 34:49. https://doi.org/10.1016/j.kjms.2017.08.007 Crossref, ISI, Google ScholarLeneveu-Jenvrin, C., et al. 2013. BMC Microbiol. 13:123. https://doi.org/10.1186/1471-2180-13-123 Crossref, Google ScholarMulet, M., et al. 2009. Mol. Cell. Probes 23:140. https://doi.org/10.1016/j.mcp.2009.02.001 Crossref, ISI, Google ScholarPeña, A., et al. 2019. Access Microbiol. 1:e000067. https://doi.org/10.1099/acmi.0.000067 Crossref, Google ScholarSoto-Rodriguez, S. A., et al. 2013. J. Appl. Microbiol. 115:654. https://doi.org/10.1111/jam.12280 Crossref, ISI, Google ScholarTayeb, L. A., et al. 2005. Res. Microbiol. 156:763. https://doi.org/10.1016/j.resmic.2005.02.009 Crossref, ISI, Google ScholarFunding: This research was supported by Guangxi Key R&D Program Project (AB18221047).The author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Vol. 107, No. 2 February 2023SubscribeISSN:0191-2917e-ISSN:1943-7692 Download Metrics Article History Issue Date: 28 Feb 2023Published: 10 Feb 2023First Look: 13 Jul 2022Accepted: 11 Jul 2022 Page: 549 Information© 2023 The American Phytopathological SocietyFundingGuangxi Key R&D Program ProjectGrant/Award Number: AB18221047Keywordsbacterial diseasesPleurotus pulmonariusPseudomonas mosseliiThe author(s) declare no conflict of interest.PDF download

Abstract:HomePlant DiseaseVol. 103, No. 11First Report of Pestalotiopsis microspora Causing Leaf Blight Disease of Machilus nanmu in China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Pestalotiopsis microspora Causing Leaf Blight Disease of Machilus nanmu in ChinaShan Han, Yuling Wang, Ming Wang, Shujiang Li, Ruoyu Ruan, Tianmin Qiao, and Tianhui ZhuShan Hanhttp://orcid.org/0000-0002-4355-7808College of Forestry, Sichuan Agricultural University, Chengdu, Sichuan Province, 611130, Sichuan, P.R. ChinaSearch for more papers by this author, Yuling WangCollege of Forestry, Sichuan Agricultural University, Chengdu, Sichuan Province, 611130, Sichuan, P.R. ChinaSearch for more papers by this author, Ming WangCollege of Forestry, Sichuan Agricultural University, Chengdu, Sichuan Province, 611130, Sichuan, P.R. ChinaSearch for more papers by this author, Shujiang LiCollege of Forestry, Sichuan Agricultural University, Chengdu, Sichuan Province, 611130, Sichuan, P.R. ChinaSearch for more papers by this author, Ruoyu RuanCollege of Forestry, Sichuan Agricultural University, Chengdu, Sichuan Province, 611130, Sichuan, P.R. ChinaSearch for more papers by this author, Tianmin QiaoCollege of Forestry, Sichuan Agricultural University, Chengdu, Sichuan Province, 611130, Sichuan, P.R. ChinaSearch for more papers by this author, and Tianhui Zhu†Corresponding author: T. H. Zhu; E-mail Address: [email protected]College of Forestry, Sichuan Agricultural University, Chengdu, Sichuan Province, 611130, Sichuan, P.R. ChinaSearch for more papers by this authorAffiliationsAuthors and Affiliations Shan Han Yuling Wang Ming Wang Shujiang Li Ruoyu Ruan Tianmin Qiao Tianhui Zhu † College of Forestry, Sichuan Agricultural University, Chengdu, Sichuan Province, 611130, Sichuan, P.R. China Published Online:28 Aug 2019https://doi.org/10.1094/PDIS-05-19-0937-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Machilus nanmu (Oliv.) Hemsl, an endemic tree species in China, is valued for its durable wood and resistance to termites and insects. Its timber is used for construction, decorative materials, and furniture. It mainly occurs in the mountainous western edge of the Sichuan Basin. M. nanmu has been increasingly planted in China over the last 10 decades for its high value. In the plantation, leaf blight disease of M. nanmu has occurred frequently, and the incidence of disease was found to be 30% over the past few years. The symptoms gradually spread from the edges of the leaves to the middle, and brown spots appeared on the diseased leaves. The leaves showed light brown spots initially and then developed irregular brown spots. The lesions gradually expanded, and the area of blight reached one-third to one-half of the leaves. There was a clear dark-brown boundary at the junction of diseased and healthy tissue. Fine black granules were visible in the late lesions, which are the fruiting bodies of the pathogen. Infected tissues usually cause leaf blight without shedding. To isolate and collect pathogenic fungi, 50 diseased leaves were cut into 5 × 5-mm pieces at the junction of disease and health. Subsequently, the samples were disinfected with 3% NaClO and 75% ethanol for 30 s, rinsed three times with sterilized water, dried on sterilized filter paper, and plated onto potato dextrose agar (PDA) at 25°C for 10 days. In total, 18 single-conidial isolates were obtained, of which 12 strains exhibited the morphology described for Pestalotiopsis microspora (Zhang et al. 2010). When the pathogens were cultured on PDA, the colonies were round, white, and flocculent. During the early stage, they showed a ringed shape. The conidiomata of the investigated fungus was 120 to 410 µm in diameter, acervuli globose, black, and semi-immersed on black PDA conidia in a slimy and glistening mass. Its conidiogenous cells were fusiform, hyaline, short, and thin-walled (Shi et al. 2015). Conidia contained five cells (per size 21.1.6 to 28.0 × 5.7 to 7.9 µm). The middle three cells were light brown to brown. The basal cell and apical cell were nearly triangular, colorless, and transparent, with two to three apical appendages 10.0 to 22.5 µm, and a basal appendage of 2.6 to 6.5 µm. DNA was extracted from the fungal colony using a DNeasy Plant Mini Kit (Qiagen). PCR was performed with primers ITS1/ITS4 of ITS region (White et al. 1990) and primers BT2A/BT2B of β-tubulin gene (TUB) (Glass and Donaldson 1995; O’Donnell and Cigelnik 1997). PCR was amplified, and its products were sequenced and blasted. BLAST results indicated that the ITS sequences (GenBank accession KX755256) had 99% similarity to P. microspora (GenBank accession MG808374), and the TUB sequences (GenBank accession MK409844) had 99% similarity to P. microspora (GenBank accession KU377338). To assess their pathogenicity, the fungi were inoculated on leaves of M. nanmu. Koch’s postulates were performed as follows: The healthy young leaves of 2-year-old potted M. nanmu were inoculated with the same pathogens by spraying 50 µl of a conidial suspension (1 × 106 spores/ml) on both sides of the leaves. Sterile water (10 plants) was used for negative controls. After 23 days, the inoculated plants showed the same symptoms as the diseased plants, and the controls remained asymptomatic. Fungi were reisolated from diseased leaves, which showed the same characteristics described above and were identical to the isolates used to inoculate plants. Therefore, it was confirmed that the leaf blight of M. nanmu was caused by P. microspora. As far as we know, this is the first report of P. microspora causing leaf blight disease on M. nanmu in China.The author(s) declare no conflict of interest.References:Glass, N. L., and Donaldson, G. C. 1995. Appl. Environ. Microbiol. 61:1323. Crossref, ISI, Google ScholarO’Donnell, K., and Cigelnik, E. 1997. Mol. Phylogenet. Evol. 7:103. https://doi.org/10.1006/mpev.1996.0376 Crossref, ISI, Google ScholarShi, H. J., et al. 2015. Plant Dis. 99:1276. https://doi.org/10.1094/PDIS-01-15-0079-PDN Link, ISI, Google ScholarWhite, T. J., et al. 1990. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA. Crossref, Google ScholarZhang, C. Q., et al. 2010. Crop Prot. 36:160. https://doi.org/10.1016/j.cropro.2012.07.018 Google ScholarS. Han, Y. L. Wang, and M. Wang contributed equally to this work.The author(s) declare no conflict of interest.Funding: Funding was provided by the General Program of Science and Technology Department of Sichuan (grant no. 19ZDYF2270).DetailsFiguresLiterature CitedRelated Vol. 103, No. 11 November 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionAdvanced symptoms of bacterial blotch disease on mushroom caps (Osdaghi et al.). Photo credit: C. Bull. Powdery mildew caused by Golovinomyces neosalviae on Salvia fruticosa (Soylu et al.). Photo credit: S. Soylu. Metrics Article History Issue Date: 4 Nov 2019Published: 28 Aug 2019First Look: 2 Jul 2019Accepted: 16 Jun 2019 Page: 2963 Information© 2019 The American Phytopathological SocietyFundingGeneral Program of Science and Technology Department of SichuanGrant/Award Number: 19ZDYF2270Keywordsleaf blight diseasePestalotiopsis microsporapathogen identificationMachilus nanmuThe author(s) declare no conflict of interest.Cited byBananaSqueezeNet: A very fast, lightweight convolutional neural network for the diagnosis of three prominent banana leaf diseasesSmart Agricultural Technology, Vol. 4First Report of Pestalotiopsis microspora Causing Leaf Blight of Banana in BangladeshMd. Abdullahil Baki Bhuiyan, Shah Mohammad Naimul Islam, Md. Ashraful Islam Bukhari, Md. Abdul Kader, Md. Zahid Hasan Chowdhury, Mohammad Zahangeer Alam, Hasan Mohammad Abdullah, and Farhana Jenny29 March 2022 | Plant Disease, Vol. 106, No. 5

First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.

First Report of <i>Pseudomonas mosselii</i> Causing White Blotch Disease in <i>Pleurotus pulmonarius</i> in China

First Report of Arthrobacter Woluwensis Causing Brown Blotch Disease on White Button Mushroom (agaricus Bisporus).

Isolation and Identification of Pseudomonas Tolaasii Causing Brown Rot on Morchella Sextelata in Guizhou Province, China

Characterization, Pathogenicity, Phylogeny, and Comparative Genomic Analysis of Pseudomonas Tolaasii Strains Isolated from Various Mushrooms in China

First Report of Aspergillus niger causing rot of Morchella sextelata in China

First Report of Brown Rot Disease on Cultivated Auricularia cornea Caused by Trichoderma pleuroticola in Sichuan Province, China

First report of Neocosmospora pisi causing blight on Ammopiptanthus mongolicus in China

Isolation and Identification of Pseudomonassis Pathogen from Cultured Pseudosciaena Crocea

Identification of a Bacterium Causing Brown Blotch Disease of Pleurotus Ostreatus.

First Report of Lecanicillium aphanocladii Causing Rot of Sparassis crispa in China

First Report of Clonostachys rosea Causing rot of Morchella sextelata in Anhui Province, China

First Report of Lecanicillium Aphanocladii Causing Rot of Sparassis Latifolia in China

First Report of Sphingobacterium Multivorum Causing Bacterial Rot of Cauliflower Mushroom (sparassis Latifolia) in China.

First Report of Bacterial Head Rot of Broccoli Caused by Pseudomonas Fluorescens in China.

Differential Analyses of Morphology and Transcription from Oyster Mushroom Pleurotus Ostreatus Response to Brown Blotch Disease

First Report of Stipe Rot Disease on Morchella Importuna Caused by Fusarium Incarnatum – F. Equiseti Species Complex in China

First Report of Lecanicillium Aphanocladii Causing Rot of Tremella Fuciformis in China

First Report of Fusarium oxysporum Causing Root Rot on Pleione bulbocodioides in China

First Report of Yellow Rot Caused by Physarum galbeum in Grifola frondosa in China

First Report of Pestalotiopsis Microspora Causing Leaf Blight Disease of Machilus Nanmu in China