Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

[Corrigendum] HORMAD1 Promotes Docetaxel Resistance in Triple Negative Breast Cancer by Enhancing DNA Damage Tolerance

Corrigendum: CAR T Cells Targeting the Tumor MUC1 Glycoprotein Reduce Triple-Negative Breast Cancer Growth

[Corrigendum] Tripartite motif‐containing 11 regulates the proliferation and apoptosis of breast cancer cells

[Corrigendum] Zoledronic acid sensitizes breast cancer cells to fulvestrant via ERK/HIF‐1 pathway inhibition in vivo

Erratum: Artemin is estrogen regulated and mediates antiestrogen resistance in mammary carcinoma

[Corrigendum] Azurocidin 1 inhibits the aberrant proliferation of triple‐negative breast cancer through the regulation of pyroptosis

[Corrigendum] Crocetin Induces Apoptosis of BGC‑823 Human Gastric Cancer Cells

[Corrigendum] SB‑T‑121205, a Next‑generation Taxane, Enhances Apoptosis and Inhibits Migration/invasion in MCF‑7/PTX Cells.

[Corrigendum] METTL3 Antagonizes 5‑FU Chemotherapy and Confers Drug Resistance in Colorectal Carcinoma.

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

[Corrigendum] Exogenous Hydrogen Sulfide Exerts Proliferation, Anti-Apoptosis, Migration Effects and Accelerates Cell Cycle Progression in Multiple Myeloma Cells Via Activating the Akt Pathway

[Corrigendum] Hsp90 inhibitor 17‑AAG inhibits stem cell‑like properties and chemoresistance in osteosarcoma cells via the Hedgehog signaling pathway

Corrigendum to ‘Mir-873/Pd-l1 Axis Regulates the Stemness of Breast Cancer Cells’ EBioMedicine 41 (2019) 395–407

[Corrigendum] P2Y2 receptor promotes the migration and invasion of breast cancer cells via EMT‑related genes Snail and E‑cadherin

[Corrigendum] Overexpression of HES6 Has Prognostic Value and Promotes Metastasis Via the Wnt/β-catenin Signaling Pathway in Colorectal Cancer.

Correction: Corrigendum: Selective inhibition of EZH2 by ZLD1039 blocks H3K27methylation and leads to potent anti-tumor activity in breast cancer

Corrigendum to 'inhibition of HDACs-EphA2 Signaling Axis with WW437 Demonstrates Promising Preclinical Antitumor Activity in Breast Cancer' [ebiomedicine 31 (2018) 276-286].

Correction To: Tumour Suppressor EP300, a Modulator of Paclitaxel Resistance and Stemness, is Downregulated in Metaplastic Breast Cancer

[Corrigendum] High PLK4 Expression Promotes Tumor Progression and Induces Epithelial‑mesenchymal Transition by Regulating the Wnt/β‑catenin Signaling Pathway in Colorectal Cancer

[Corrigendum] Role of 4‑aminobutyrate Aminotransferase (ABAT) and the Lncrna Co‑expression Network in the Development of Myelodysplastic Syndrome

Corrigendum: Inhibition of O-GlcNAc Transferase Sensitizes Prostate Cancer Cells to Docetaxel