Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Correction: Regucalcin promotes dormancy of prostate cancer

Author Correction: An oncogene–tumor suppressor cascade drives metastatic prostate cancer by coordinately activating Ras and nuclear factor-κB

[Corrigendum] HepaCAM inhibits cell proliferation and invasion in prostate cancer by suppressing nuclear translocation of the androgen receptor via its cytoplasmic domain

KLF5 downregulation desensitizes castration-resistant prostate cancer cells to docetaxel by increasing BECN1 expression and inducing cell autophagy: Erratum

Correction: Loss of EGFR Signaling-Regulated Mir-203 Promotes Prostate Cancer Bone Metastasis and Tyrosine Kinase Inhibitors Resistance

Correction: The CDK7 inhibitor CT7001 (Samuraciclib) targets proliferation pathways to inhibit advanced prostate cancer

Correction: A Novel Highly Potent Trivalent TGF-β Receptor Trap Inhibits Early-Stage Tumorigenesis and Tumor Cell Invasion in Murine Pten-deficient Prostate Glands

[Corrigendum] Azurocidin 1 inhibits the aberrant proliferation of triple‐negative breast cancer through the regulation of pyroptosis

Corrigendum: Pyruvate kinase M2 promotes prostate cancer metastasis through regulating ERK1/2-COX-2 signaling

Correction: Gupta et al. Androgen Receptor Activation Induces Senescence in Thyroid Cancer Cells. Cancers 2023, 15, 2198

Correction: PLK1 promotes proliferation and suppresses apoptosis of renal cell carcinoma cells by phosphorylating MCM3

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

Corrigendum: EXOSC5 As a Novel Prognostic Marker Promotes Proliferation of Colorectal Cancer Via Activating the ERK and AKT Pathways

Corrigendum: GPER1 Silencing Suppresses the Proliferation, Migration, and Invasion of Gastric Cancer Cells by Inhibiting PI3K/AKT–Mediated EMT

[Corrigendum] PRIMA‐1 met induces autophagy in colorectal cancer cells through upregulation of the mTOR/AMPK‐ULK1‐Vps34 signaling cascade

Correction: Corrigendum: Genetic Variation in the Prostate Stem Cell Antigen Gene PSCA Confers Susceptibility to Urinary Bladder Cancer

Correction: Up-Regulation of 91H Promotes Tumor Metastasis and Predicts Poor Prognosis for Patients with Colorectal Cancer.

Long noncoding RNA TUG1 promotes progression via upregulating DGCR8 in prostate cancer

Correction: Intracellular regulation of zinc by metal–organic framework-mediated genome editing for prostate cancer therapy

Correction to: CRL4DCAF4 E3 ligase-mediated degradation of MEN1 transcriptionally reactivates hTERT to sustain immortalization in colorectal cancer cells

Corrigendum: Comprehensive transcriptomic analysis of critical RNA regulation associated with metabolism and prognosis in clear cell renal carcinoma