Abstract:In this study, L-lactate dehydrogenase (Lr-L-LDH) from Lactobacillus rhamnosus was investigated. The well-known Lr-L-LDH1 was taken as the control, differences between Lr-L-LDH1 and Lr-L-LDH2 annotated from the genome of L. rhamnosus were analyzed. The primary structure, basic properties, hydrophobicity, secondary structure of Lr-L-LDH1 and Lr-L-LDH2 were predicted and analyzed using online websites and professional software. Homology modeling of the tertiary structure, molecular docking of enzymes and substrates, phylogenetic analysis, in vitro cloning, expression, and enzyme activity assays were further studied. The results showed that, in comparison to Lr-L-LDH1, although Lr-L-LHD2 had similar molecular characteristics, secondary and tertiary structures, Lr-L-LHD2 exhibited differences: A shorter sequences, low amino acid identities (48.08%), and a different phylogenetic status. Lr-L-LHD2 also contained a catalytically active site, a highly conserved NAD+ binding site sequence (GXGXXG), a three-dimensional active pocket domain, was an NAD+ dependent tetrameric L-lactate dehydrogenase, and be activated by fructose 1,6-diphosphate in the cytoplasm for catalyzing the reduction of pyruvate to L-lactic acid. In vitro enzyme activity was significantly lower than Lr-L-LDH1 (P<0.01). In conclusion, both Lr-L-LDH1 and Lr-L-LHD2 showed enzyme activities of L-lactate dehydrogenase, indicating they may regulate the L-lactate metabolism pathway together. Considerations of both Lr-L-LDH1 and Lr-L-LHD2 should be taken for the future molecular modifications of L-LDH in L. rhamnosus, and the study provided the molecular and scientific basis for the gene engineering modifications of lactic acid fermentation industry.

Characterization and Functional of Four Mutants of Hydroxy Fatty Acid Dehydrogenase from Lactobacillus Plantarump-8.

Kinetics and Function of Two Mutants of CLA Hydrase from Lactobacillus Plantarum P-8

Expression and characterization of two L-aspartate alpha-decarboxylases

MD and QM/MM Studies on Long-Chain L-Α-hydroxy Acid Oxidase: Substrate Binding Features and Oxidation Mechanism

Kinetics of microbial hydrogenation of free linoleic acid to conjugated linoleic acids

Bioinformatics Analysis and Gene Cloning of L-Lactate Dehydrogenase from Lactobacillus rhamnosus

Gctgtcaaca cccatggctg agagctc nthg nthr gagctctcagccatgggtgttgacagc hthl gctgtccaca cccatggctg agagctc hthg hthr gagctctcagccatgggtgtggacagc nahl gctgtcaacg cccatggctg agagctc nahg nahr gagctctcagccatgggcgttgacagc nshr gctgtcaact cccatggctg agagctc nshg nshl gagctctcagccatgggagttgacagc athl gctgtcgc

Role of 10-hydroxy-cis-12-octadecenic acid in transforming linoleic acid into conjugated linoleic acid by bifidobacteria

Characterization of the linoleic acid Δ9 hydratase catalyzing the first step of polyunsaturated fatty acid saturation metabolism in Lactobacillus plantarum AKU 1009a

Cloning and Characterization of Genes Encoding Reactivating Factor Pdugh from Lactobacillus Collinoides

Characterization and Modification of Two Self-Sufficient CYP102 Family Enzymes from Bacillus Amyloliquefaciens DSM 7 with Distinct Regioselectivity Towards Fatty Acid Hydroxylation

Modified Catalytic Performance of Lactobacillus Fermentum L-Lactate Dehydrogenase by Rational Design

Comparison of Enzymatic Activity of Two Linoleic Acid Isomerases Expressed in E. Coli.

Characterization of a D-Lactate Dehydrogenase from Lactobacillus Fermentum JN248 with High Phenylpyruvate Reductive Activity

Expression and purification of His-tagged rat mitochondrial short-chain 3-hydroxyacyl-CoA dehydrogenase wild-type and Ser137 mutant proteins.

Structural and Functional Characterization of a Novel Acidophilic 7α‐hydroxysteroid Dehydrogenase

Thermostable Lipases from Extremely Radioresistant Bacterium Deinococcus Radiodurans: Cloning, Expression, and Biochemical Characterization.

Directed Modification of L-Lcldh1, an L-Lactate Dehydrogenase from Lactobacillus Casei, to Improve Its Specific Activity and Catalytic Efficiency Towards Phenylpyruvic Acid.

Purification and Initial Characterization of 3-Hydroxybenzoate 6-Hydroxylase from a Halophilic Martelella Strain AD-3

Screening, Identification and Breeding of Conjugated Linoleic Acid-producing Lactobacillus Plantarum by Mutation

Promoting the production of conjugated linoleic acid by optimizing the fermentation parameters of Lactobacillus sp