Abstract:Long-chain L-α-hydroxy acid oxidase (LCHAO) is a flavin mononucleotide (FMN)-dependent oxidase that dehydrogenates l-α-hydroxy acids to keto acids. There were two different mechanisms, named as hydride transfer (HT) mechanism and carbanion (CA) mechanism, respectively, proposed about the catalytic process for the FMN-dependent L-α-hydroxy acid oxidases on the basis of biochemical data. However, crystallographic and kinetic studies could not provide enough evidence to prove one of the mechanisms or eliminate the alternative. In the present studies, theoretical computations were carried out to study the molecular mechanism for LCHAO-catalyzed dehydrogenation of L-lactate. Our molecular dynamics (MD) simulations indicated that L-lactate prefers to bind with LCHAO in a hydride transfer mode rather than a carbanion mode. Quantum mechanics/molecular mechanics (QM/MM) calculations were further carried out to obtain the optimized structures of reactants, transition states, and products at the level of ONIOM-EE (B3LYP/6-311++G(d,p)//B3LYP/6-31G(d,p):AMBER). Quantum chemical studies indicated that LCHAO-catalyzed dehydrogenation of L-lactate would be a stepwise catalytic reaction in a hydride transfer mechanism but not a carbanion mechanism. MD simulations, binding free energy calculations, and QM/MM computations were also implemented on the complex between L-lactate and Y129F mutant LCHAO. By comparing the Y129F mutant system with the wild-type system, it was further confirmed that the key residue Tyr129 in the active site of LCHAO would not affect L-lactate's binding to LCHAO but play an important role on the catalytic reaction process through an H-bond interaction.

Characterization of the linoleic acid Δ9 hydratase catalyzing the first step of polyunsaturated fatty acid saturation metabolism in Lactobacillus plantarum AKU 1009a

Characterization and Functional of Four Mutants of Hydroxy Fatty Acid Dehydrogenase from Lactobacillus Plantarump-8.

Kinetics and Function of Two Mutants of CLA Hydrase from Lactobacillus Plantarum P-8

Dose-dependent production of linoleic acid analogues in food derived Lactobacillus plantarum K25 and in silico characterization of relevant reactions

Isolation and Purification of Linoleate Isomerase from Lactobacillus Acidophilus and Its Enzymology Characteristics

Characterization of linoleic Acid isomerase from Lactobacillus delbreckiisup sp.

MD and QM/MM Studies on Long-Chain L-Α-hydroxy Acid Oxidase: Substrate Binding Features and Oxidation Mechanism

Identification of a Δ12 Fatty Acid Desaturase from Oil Palm (elaeis Guineensis Jacq.) Involved in the Biosynthesis of Linoleic Acid by Heterologous Expression in Saccharomyces Cerevisiae.

Molecular Cloning and Heterologous Expression of Linoleic Acid Isomerase Gene from Lactobacillus Reuteri and Lactobacillus Acidophilus

Purification of Linoleic Acid Isomerase from Recombinant E.coli by Affinity Chromatography

Purification and characterization of 1-acyl-sn-glycerol-3-phosphate acyltransferase with a substrate preference for polyunsaturated fatty acyl donors from the eicosapentaenoic acid-producing bacterium Shewanella livingstonensis Ac10

Gctgtcaaca cccatggctg agagctc nthg nthr gagctctcagccatgggtgttgacagc hthl gctgtccaca cccatggctg agagctc hthg hthr gagctctcagccatgggtgtggacagc nahl gctgtcaacg cccatggctg agagctc nahg nahr gagctctcagccatgggcgttgacagc nshr gctgtcaact cccatggctg agagctc nshg nshl gagctctcagccatgggagttgacagc athl gctgtcgc

Purification and Partial Characterization of Lipoxygenase in Cherry-valley Duck Breast Muscle

Efficient Transformation of Linoleic Acid into 13(S)-Hydroxy-9,11-(z,e)-octadecadienoic Acid Using Putative Lipoxygenases from Cyanobacteria

Comparison of Enzymatic Activity of Two Linoleic Acid Isomerases Expressed in E. Coli.

Effects of the engineering of a single binding pocket residue on specificity and regioselectivity of hydratases from Lactobacillus Acidophilus

Cloning and characterization of a hyaluronate lyase EsHyl8 from Escherichia sp. A99

Heterologous Expression of Production of T10, C12-CLA Linoleic Acid Isomerase Gene from Propionibacterium Acnes

Expression of Linoleate Isomerase Gene from Lactobacillus Reuteri PYR8 in Pichia Pastoris

Expression, Characterization, and Immobilization of a Novel D-Lactate Dehydrogenase from Salinispirillum Sp. LH 10-3-1

Purification and Characterization of Lipoxygenase from Entermorpha Clathrata