Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Erratum: Targeted Expression of Escherichia Coli Purine Nucleoside Phosphorylase and Fludara® for Prostate Cancer Therapy

Corrigendum for “A Novel Kinase Subverts Aluminium Resistance by Boosting Ornithine Decarboxylase‐dependent Putrescine Biosynthesis”

Correction To: Therapeutic Efficacy, Pharmacokinetic Profiles, and Toxicological Activities of Humanized Antibody-Drug Conjugate Zt/g4-MMAE Targeting RON Receptor Tyrosine Kinase for Cancer Therapy

Correction To: Early Presence of Anti-Angiogenesis-related Adverse Events As a Potential Biomarker of Antitumor Efficacy in Metastatic Gastric Cancer Patients Treated with Apatinib: a Cohort Study

Correction: Corrigendum: Genetic Variation in the Prostate Stem Cell Antigen Gene PSCA Confers Susceptibility to Urinary Bladder Cancer

[Corrigendum] Adenoviral neutral endopeptidase gene delivery in combination with paclitaxel for the treatment of prostate cancer

Corrigendum: The efficacy and safety analysis of first-line immune checkpoint inhibitors in pulmonary sarcomatoid carcinoma

Erratum: Artemin is estrogen regulated and mediates antiestrogen resistance in mammary carcinoma

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

Erratum: Sorafenib promotes graft-versus-leukemia activity in mice and humans through IL-15 production in FLT3-ITD-mutant leukemia cells

Erratum to: Linc00152 promotes proliferation in gastric cancer through the EGFR-dependent pathway

[Corrigendum] HepaCAM inhibits cell proliferation and invasion in prostate cancer by suppressing nuclear translocation of the androgen receptor via its cytoplasmic domain

Erratum: Multifunctional Polyethylene Glycol (Peg)-Poly (Lactic-Co-glycolic Acid) (Plga)-Based Nanoparticles Loading Doxorubicin and Tetrahydrocurcumin for Combined Chemoradiotherapy of Glioma

Correction: Infiltrating Mast Cells Increase Prostate Cancer Chemotherapy and Radiotherapy Resistances Via Modulation of P38/p53/p21 and ATM Signals.

Corrigendum to: Progress of Angiogenesis Signal Pathway and Antiangiogenic Drugs in Nasopharyngeal Carcinoma

Erratum: Corrigendum: Prognostic role of Gli1 expression in solid malignancies: a meta-analysis

Correction: Fararjeh, A-F S., et al. ZBTB46, SPDEF, ETV6 Novel Potential Biomarkers and Therapeutic Targets in Castration Resistance Prostate Cancer. Int. J. Mol. Sci. 2019, 20, 2802

Erratum to preoperative prediction of gastrointestinal stromal tumors with high Ki-67 proliferation index based on CT features

Correction: Corrigendum: Prognostic role of Gli1 expression in solid malignancies: a meta-analysis

[Corrigendum] Nucleosome‐binding protein HMGN2 exhibits antitumor activity in human SaO2 and U2‐OS osteosarcoma cell lines

Correction: Loss of EGFR Signaling-Regulated Mir-203 Promotes Prostate Cancer Bone Metastasis and Tyrosine Kinase Inhibitors Resistance