Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Erratum: SPOP targets oncogenic protein ZBTB3 for destruction to suppress endometrial cancer.

Erratum: Targeting NF-κB/AP-2β Signaling to Enhance Antitumor Activity of Cisplatin by Melatonin in Hepatocellular Carcinoma Cells.

Corrigendum: CAR T Cells Targeting the Tumor MUC1 Glycoprotein Reduce Triple-Negative Breast Cancer Growth

SPOP Targets Oncogenic Protein ZBTB3 for Destruction to Suppress Endometrial Cancer

Correction To: Methylseleninic Acid Suppresses Breast Cancer Growth Via the JAK2/STAT3 Pathway

Erratum to "Protein Z modulates the metastasis of lung adenocarcinoma cells"

Corrigendum: Downregulation of GLYAT Facilitates Tumor Growth and Metastasis and Poor Clinical Outcomes Through the PI3K/AKT/Snail Pathway in Human Breast Cancer

Erratum: Epigenomic characterization of a p53-regulated 3p22.2 tumor suppressor that inhibits STAT3 phosphorylation via protein docking and is frequently methylated in esophageal and other carcinomas: Erratum.

Corrigendum: Targeting ACLY Attenuates Tumor Growth and Acquired Cisplatin Resistance in Ovarian Cancer by Inhibiting the PI3K–AKT Pathway and Activating the AMPK–ROS Pathway

Erratum: Transcriptional Downregulation of Mir-4306 Serves As a New Therapeutic Target for Triple Negative Breast Cancer: Erratum.

Corrigendum: Targeting Myc Interacting Proteins As a Winding Path in Cancer Therapy

Erratum: Targeting sphingosine kinase 2 suppresses cell growth and synergizes with BCL2/BCL-XL inhibitors through NOXA-mediated MCL1 degradation in cholangiocarcinoma.

Targeting Epstein-Barr virus oncoprotein LMP1-mediated high oxidative stress suppresses EBV lytic reactivation and sensitizes tumors to radiation therapy: Erratum

[Corrigendum] Azurocidin 1 inhibits the aberrant proliferation of triple‐negative breast cancer through the regulation of pyroptosis

Erratum to "Ultrasound Controllable Release of Proteolysis Targeting Chimeras for Triple-Negative Breast Cancer Treatment"

Erratum: A CRISPR Interference of CBP and p300 Selectively Induced Synthetic Lethality in Bladder Cancer Cells In Vitro: Erratum.

EFEMP2 suppresses epithelial-mesenchymal transition via Wnt/β-catenin signaling pathway in human bladder cancer: Erratum

Correction to: PPDPF promotes lung adenocarcinoma progression via inhibiting apoptosis and NK cell-mediated cytotoxicity through STAT3

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

Erratum: [Corrigendum] miR‑216a‑5p acts as an oncogene in renal cell carcinoma.

Corrigendum to “Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells”