Establishment of Stable SSA/Ro52 Gene Silencing Cell Lines by Lentiviral Vectors

Juan GUO,Wei ZHOU
DOI: https://doi.org/10.3969/j.issn.1673-8705.2014.03.010
2014-01-01
Abstract:Objective ToestablishthestableSSA/Ro52genesilencingcelllinesbylentiviralvestorsexpressing RNA interference molecule which should be powerful tools facilitating the study of SSA/Ro52 function. Methods Four specific sequences of SSA/Ro52 (clone 1 TGGCATGGTCTCCTTCTACAA;clone 2 CTGCCT-TCTTTATGGGACTTA;clone 9 TGAGAAGTTGGAAGTGGAAAT;clone 1 1 AGTTATCCTATGGTCCTGG-GT)and unrelated control sequence S were cloned into lentiviral vector pLKO-puro,which could express short hairpin RNA (shRNA)and inhibit expression of specific gene by RNA interference mechanism. Clone 1,2,9,11 which expressing SSA/Ro52 specific sequences and control clone S were packed with pGag-Pol and pVSV-G respectively,then 293 T cells were co-transfected. Culture medium containing virus particles were collected. The viral particles which expressing specific sequences SSA/Ro52 and unrelated control sequences were used to infected Hela cells,after antibiotic selection,stable cell lines were established. We used GAPDH as an internal control in real-time PCR for the detecting of SSA/Ro52 mRNA expression. Immunoblot was performed to detect SSA/Ro52 protein expression. The degree of gene expression inhibition was represented by the ratio of SSA/Ro52 expression level in Clone1,2,9,11 transfected cells and that in cloneS.Results LentiviruseffectivelyinfectedHelacells,thevectorDNAcontainingshRNAexpressing cassette were integrated into the cellullar gemone and stable cell lines were established. After antibiotics screening for 3 days,compared to transfected cells,the control clone S,the mRNA level of SSA/Ro52 of the transfected cells Clone 1,2,9,11 were 25. 5%,31. 2%,13. 0% and 77. 2%,respectively. While the protein level of SSA/Ro52 in the experimental group were 5%,50%,10%and 80%. After 4 weeks of culture,SSA/Ro52 protein expression did not change significantly. After stimulated by interferonα(IFN-α), the transfected cells with control clone expressed increased level of SSA/Ro52 protein;while the protein level ofSSA/Ro52intheexperimentalgroupwere30%,70%,5%and100%.Conclusions Lentiviralvector clone 1 ,2 and 9 can significantly inhibit the expression of SSA/Ro52 and the stable SSA/Ro52 gene silencing cell lines have been successfully established. When SSA/Ro52 is upregulated by INF-α,clone 9 can still inhibit the expression of SSA/Ro52 effectively and can be used as a tool to study the function of SSA/Ro52.
What problem does this paper attempt to address?