Abstract:Objective ToestablishthestableSSA/Ro52genesilencingcelllinesbylentiviralvestorsexpressing RNA interference molecule which should be powerful tools facilitating the study of SSA/Ro52 function. Methods Four specific sequences of SSA/Ro52 (clone 1 TGGCATGGTCTCCTTCTACAA;clone 2 CTGCCT-TCTTTATGGGACTTA;clone 9 TGAGAAGTTGGAAGTGGAAAT;clone 1 1 AGTTATCCTATGGTCCTGG-GT)and unrelated control sequence S were cloned into lentiviral vector pLKO-puro,which could express short hairpin RNA (shRNA)and inhibit expression of specific gene by RNA interference mechanism. Clone 1,2,9,11 which expressing SSA/Ro52 specific sequences and control clone S were packed with pGag-Pol and pVSV-G respectively,then 293 T cells were co-transfected. Culture medium containing virus particles were collected. The viral particles which expressing specific sequences SSA/Ro52 and unrelated control sequences were used to infected Hela cells,after antibiotic selection,stable cell lines were established. We used GAPDH as an internal control in real-time PCR for the detecting of SSA/Ro52 mRNA expression. Immunoblot was performed to detect SSA/Ro52 protein expression. The degree of gene expression inhibition was represented by the ratio of SSA/Ro52 expression level in Clone1,2,9,11 transfected cells and that in cloneS.Results LentiviruseffectivelyinfectedHelacells,thevectorDNAcontainingshRNAexpressing cassette were integrated into the cellullar gemone and stable cell lines were established. After antibiotics screening for 3 days,compared to transfected cells,the control clone S,the mRNA level of SSA/Ro52 of the transfected cells Clone 1,2,9,11 were 25. 5%,31. 2%,13. 0% and 77. 2%,respectively. While the protein level of SSA/Ro52 in the experimental group were 5%,50%,10%and 80%. After 4 weeks of culture,SSA/Ro52 protein expression did not change significantly. After stimulated by interferonα(IFN-α), the transfected cells with control clone expressed increased level of SSA/Ro52 protein;while the protein level ofSSA/Ro52intheexperimentalgroupwere30%,70%,5%and100%.Conclusions Lentiviralvector clone 1 ,2 and 9 can significantly inhibit the expression of SSA/Ro52 and the stable SSA/Ro52 gene silencing cell lines have been successfully established. When SSA/Ro52 is upregulated by INF-α,clone 9 can still inhibit the expression of SSA/Ro52 effectively and can be used as a tool to study the function of SSA/Ro52.

Construction of Recombinant Lentiviral Vector of siRNA for Arnt and the Expression of Recombinant Vector in HCCLM6

Construction and identification of vector against Kir6.2 gene expression in hepatoma cells by short interfering RNAs

Construction of Microrna Let-7C Lentiviral Vector and Its Overexpression

BC047440 silencing in HepG2 cells mediated by lentiviral vector

Construction and Identification of Lentiviral Vector-mediated RNA Interference of Epidermal Growth Factor Receptor

[Construction of Shrna Expression Vector Silencing Kir6.2 Gene and to Study Its Influence on the Proliferation and Invasion of HepG2 Cells].

Construction of hsa-miR-152lentiviral vector and screening of cell strain for stable expression

Construction of Lncrna4.9 Interfering Lentivirus Vector

Construction of a lentiviral RNA interference system targeting heparanase based on miR30 and its silencing effect]

Construction of shRNA expression vector targeting AATF and establishment of stably transfected U937 cells]

Construction and Identification of a Recombinant Lentiviral Vector of RNA Interference of Lung Cancer Related Gene SLC35F2

Expression of NANOG Gene in Acute Lymphoblastic Leukemia Cells and Construction of Lentiviral Vector Carrying NANOG Specific shRNA

Construction and Identification of RNAi Lentiviral Vector Targeting Rat Recombination Activating Gene 1

Construction of STAT3 Shrna Lentiviral Vector

Construction and Identification of Lentiviral Vector Containing Human ILK-shRNA and Mda7 Gene

Construction of Mouse Hepatoma Hca-P with Stable Knockdown of ANXA11 Gene

Construction of shRNA Lentiviral Vector Targeting Mice IL-35 Gene and Identification of RNAi Efficiency

Construction of heparanase gene-targeted small interfering RNA and its gene silencing effect]

Construction and Identification of Lentiviral Vector of RNA Interference of CXCR4 Gene

Establishment of Stable SSA/Ro52 Gene Silencing Cell Lines by Lentiviral Vectors

TALEN/CRISPR-mediated Engineering of a Promoterless Anti-Viral RNAi Hairpin into an Endogenous Mirna Locus