Advances in Banana Root Knot Nematode in China

LIU Zhi-ming,QIN Bi-xia,CHEN Yong-hui,LU Xiu-hong

DOI: https://doi.org/10.3969/j.issn.0529-1542.2005.01.004

2005-01-01

Plant Protection

Abstract:Advances in banana root-knot nematodes, including species identification, population distribution, bionomics and their control in China were reviewed, and their future researches were also prospected in this paper.

What problem does this paper attempt to address?

Research Advances in Tomato Root Knot Nematode Disease

LI Xu-qing,ZHENG Jing-wu,ZHENG Ji-rong,RUAN Song-lin

DOI: https://doi.org/10.3969/j.issn.1004-1524.2012.04.039

2012-01-01

Abstract:This paper briefly reviewed the research progresses in tomato nematode species,pathogen,damage suymptom,biological characteristics,classification methods,resistance evaluation,control measurement,resistance breeding and Mi gene.Moreover,the future development trend was prospected.
Advances of Studies on Biological Control of Vegetable Root-knot Nematode in Installation Cultivation

Liang Jiangen,Zheng Jingwu

2010-01-01

Abstract:In recent years, with the rapid development of installation cultivation of vegetable, many questions which constraint its development appeared. Among them, nematode disease is one of the most important constraint factors, one of which the harm caused by the root-knot nematodes (Meloidogyne spp.) is the most serious. Root-knot nematode is internal parasites settlement in plant roots, which has become one of most governing pathogen threaten to agricultural for its widespread and more parasites. In the past, chemicals were used to control this disease, combined with agricultural control and the use of resistant varieties, but has its limitations. With the advancement of technology and enhanced awareness of environmental protection, biological control has aroused a great attention. This paper reviews the advances of various biological control factors, and important factors influenced the efficiencies of biological control to nematode were analyzed thoroughly, in the last, the application prospect of the biological control were reviewed.
Approaches and Advances on the Classification and Identification of Root Knot Nematode

WU Yang,ZHENG Jing-wu,SHANG Han-wu,HONG Wen-ying

DOI: https://doi.org/10.3969/j.issn.1004-1524.2005.02.013

2005-01-01

Abstract:This paper briefly reviews the taxonomical history and classification methods of the genus Meloidogyne and their advantages and disadvantages, and introduced and analyzed molecular taxonomic approaches and their application prospects.
Morphological identification of two root-knot nematode species occurring in vegetable crops of Zhejiang,China

ZHAO Lei,GUO Kai,HONG Wen-ying,ZHENG Jing-wu

DOI: https://doi.org/10.3785/j.issn.1008-9209.2010.06.005

2010-01-01

Abstract:During 2007 to 2009,an extensive survey and morphological identification on root-knot nematodes,Meloidogyne spp.,occurring in vegetable crops of Zhejiang,China,were carried out.Based on diagnostic characters and morphometrics of females,males,and second-stage juveniles,especially the perineal patterns of female,two species were identified,i.e.M.incognita and M.javanica,in which M.incognita was the preponderant species,widely distributed in vegetable crops of Zhejiang,whereas M.javanica was only found in Wenzhou of Zhejiang,and this was the first record of the species in Zhejiang.
Recent Advances in Molecular Biology Research of a Rice Pest, the Brown Planthopper

Bao Yan-yuan,Zhang Chuan-xi

DOI: https://doi.org/10.1016/s2095-3119(17)61888-4

IF: 4.8

2019-01-01

Journal of Integrative Agriculture

Abstract:The brown planthopper, Nilaparvata lugens Stål, has become a major threat in tropical Asian and China since the rice green revolution of the 1960s. Currently, insecticide application remains the primary choice for controlling this rice insect pest, but heavy use of insecticides poses dangerous risks to beneficial natural enemies and pollinators, and stimulates N. lugens reproductivity, and has caused a resurgence of the pest in the major rice-planting regions throughout Asia. Achieving the long-lasting goal of sustainable management of N. lugens requires understanding of the molecular basis of outbreaks of the pest and the development of environment-friendly pest-control strategies. Here, we review the recent molecular advances in N. lugens research on the aspects of its endosymbionts, virus transmission, insecticide resistance, and interaction between N. lugens and rice plants. We also put forward further research directions that may shed some lights on management of the rice pest.
Morphological and Molecular Characterization of the Rice Root-Knot Nematode, Meloidogyne Graminicola, Golden and Birchfeild, 1965 Occurring in Zhejiang, China

Tian Zhong-ling,Munawar Maria,Eda Marie Barsalote,Pablo Castillo,Zheng Jing-wu

DOI: https://doi.org/10.1016/s2095-3119(18)61971-9

2018-01-01

Abstract:The rice root-knot nematode Meloidogyne graminicola is a severe pest of rice. In China, it was first reported from Hainan Province, and later from several other provinces. In the present study, a rice root-knot nematode population found from the rice cultivation areas of Zhejiang Province, China is characterized via molecular analysis using internal transcribed spacer (ITS) and cytochrome c oxidase subunit II (coxII)-16S rRNA genes and scanning electron microscopy (SEM) observations of males and the second-stage juveniles. Morphometric data and molecular sequence comparisons for all M. graminicola populations occurring in China are also provided. The overall morphology of M. graminicola found in Zhejiang match well with the original description, though males have a slightly longer body and stylet, and a shorter tail, while the second-stage juvenile is also slightly longer than in the original description. This is the first report of M. graminicola from Zhejiang. Phylogenetic studies based on coxII suggest that all the Chinese populations belong to Type B. This study expands knowledge of the increasing distribution and phylogenetic relationships of M. graminicola that occur in China.
Recent research progress of soil nematode ecology in China

Si-Wei Liang,Xiao-Tong Liu,Ying-Bin Li,Wen-Ju Liang

DOI: https://doi.org/10.13287/j.1001-9332.202408.031

Abstract:Soil nematodes are a crucial component of belowground ecosystems. Soil nematode ecology, the studies of community distribution, structural composition, ecological functions, and interaction mechanisms with environment, has always been a hot spot in soil biology research. We systematically elaborated soil nematodes' high diversity and various diet, their advantages as bioindicator and model organisms, and their roles in biological control, ecological functions and soil health. Then, we reviewed the research progress of soil nematode ecology in China, including molecular biology identification methods, responses to global changes, food web structure and function, aboveground and belowground diversity relationship, and large-scale diversity pattern. We put forward the development trend of soil nematology, focusing on the high-throughput sequencing technology in nematode identification and quantification, the necessity of establishing a universal analysis platform to promote soil nematode research, and the importance of strengthening large-scale soil nematode survey.
Morphological identification and description of three rice root nematodes occurring in China

Mei YuanYuan,Guo Kai,Zheng JingWu

2009-01-01

Abstract:According to the morphological characters and morphometrics,three species in genus Hirschmanniella were identified.They were H.oryzae,H.mucronata and H.gracilis.Some morphometrics of H.oryzae and H.mucronata varied slightly from the original descriptions of type specimens,most of other morphometric data were within the reference value range.Compared to the original descriptions of type specimen,the data of H.gracilis were smaller.This was the first report of H.gracilis in Zhejiang Province,eastern China.
Field Efficacy Trail of Different Nematicides on Controlling Cucumber Root Knot Nematodes

LI Xuqing,ZHENG Jingwu,ZHENG Jirong,ZHOU Yifei,WANG Hong

DOI: https://doi.org/10.3865/j.issn.1001-3547.2012.12.028

2012-01-01

Abstract:The field trial was carried out to study and compare control efficiency of ten nematicides(10% fosthiazate GR,48% chlorpyrifos EC,1.8% avermectins EC,15.5% ememectin benzoate·chlorpyrifos EC,5% carbosulfan GR,5% carbosulfan·chlorpyrifos GR,5% cadusafos GR,10 billion/g paecilomyces lilacinus,0.5% avermectins WP,15% Chinese herbal medicine WP) on cucumber root knot nematodes.The results showed that,the five nematicides,10% fosthiazate GR,5% carbosulfan·chlorpyrifos GR,5% cadusafos GR,10 billion/g paecilomyces lilacinus and 0.5% avermectins WP,showed good control effects on cucumber root knot nematodes after 45 days and 70 days of spraying the nematicides.And the five nematicides were lower toxic and more safety for vegetable products,and they could be used to control cucumber root knot nematodes in the future.
Heterodera koreana,a new record of cyst-forming nematodes in Zhejiang Province,China

Hongxue ZHU,Zhongling TIAN,Ruihang CAI,Xiaolin LI,Jingwu ZHENG

DOI: https://doi.org/10.3785/j.issn.1008-9209.2016.10.071

2017-01-01

Abstract:Cyst-forming nematode is an important plant parasitic nematode group,in which over 80 species were reported and described.There are many economically important cyst-forming nematodes species in China,such as Heterodera glycines,Heterodera avenae,and Heterodera filipjevii.During 2015—2016,a survey for cyst-forming nematodes in Zhejiang,eastern China,revealed the distribution of a cyst-forming nematode population from Phyllostachys praecox in Lin'an,Zhejiang,eastern China.Morphological characteristics and morphometrics of cysts and second-stage juveniles (J2s)were observed and measured using light microscope and scanning electron microscope.Cysts were characterized by appearing light to dark brown in coloration,globose to subspherical shape of body contour,distinct neck and cone,lacking underbridge,bullae and fenestrae,body length ranging from 575.0 to 1230.0μm,body width ranging from 397.0 to 872.0μm,and vulva slit length ranging from 36.7 to 50.9μm.J2 was characterized by hemispherical labial region,nearly continuous with round body contour and stylet knobs,three incisures in lateral field,tail tapering and tail hyaline region accounting for 55% 75%,body length ranging from 426.3 to 608.0μm;body width ranging from 15.9 to 29.3μm;stylet length ranging from 17.7 to 21.9μm;dorsal gland orifice ranging from 4.3 to 6.2μm;tail length ranging from 68.7 to 84.5μm.Amplification of the ITS and D2/D3 fragments of the cyst-forming nematodes from bamboo with universal primers AB28 (ATATGCTTAAGTTCAGCGGGT)and TW81 (GTTTCCGTAGGTGAACCTGC),D2 A (ACAAGTACCGTGA GGGAAAGTTG)and D3B (TCGGAAGGAACCAGCTACTA)yielded PCR fragments with sizes of 1006 bp (GenBank:KX640828)and 786 bp (GenBank:KX640827),respectively,the sequences of ITS and D2/D3 of cyst nematodes parasitizing on bamboo were 99.7% and 99.6% similar to that of Heterodera koreana deposited in GenBank,respectively.Combined with morphological, morphometrics and molecular phylogeny analysis, the results showed that the cyst nematodes parasitizing on bamboo from Lin'an,Zhejiang,China is H.koreana,is a new record in Zhej iang,Eastern China.
Investigation of Root-knot Nematodes in East China

G. Karssen,W. Wesemael,M. Moens

2001-01-01

Forest Research Open Access

Abstract:The fauna of the root knot nematodes was investigated from 104 samples in six provinces of East China. The root knot nematodes on 65 species of host plants were identified as Meloidogyne incognita, M.arenaria and M.javanica by the perineal patterns and the esterase isozymes. The occurrence frequencies of them were 88%, 4% and 8%, respectively. M.incognita was the most common species. 26 of the 65 host plants were recorded for the first time in China. The results of investigation can be used as reference to work out a control scheme of the root knot nematodes in this region.
Research progress on biological control of Tuta absoluta (Meyrick)

ZHANG Jinyi,ZHANG Yadong,Asim MUNAWAR,ZHENG Yaqiang,ZHU Zengrong,ZHOU Wenwu

DOI: https://doi.org/10.3785/j.issn.1008-9209.2022.04.063

2023-01-01

Abstract:Tuta absoluta（Meyrick） is a devastating invasive pest originating from South America. It has spread rapidly to Europe, Africa, and Asia, and has invaded China in recent years, and now is a highly potential threat to the solanaceous crop industry in China. Due to its characteristics of leaf mining, fruit burrowing, short life history, high reproductivity, etc., its control effect relying on chemical pesticides is limited. Many theoretical studies and application explorations have been carried out for developing the biological control strategies for Tuta absoluta in the world, and a lot of biological control agents with high potential for usage have been screened. In this review, we summarized the research progress on the global biological control of Tuta absoluta, focusing on the parasitic and predatory natural enemy insects, the bio-control microbes, and the repellent plants and their chemical extracts. In the green control of Tuta absoluta in China, in-depth studies could be carried out on the introduction of biocontrol species suitable for the agricultural niche in China, the digging of local biocontrol resources, and the industrialization of these biocontrol organisms; meanwhile, the integrative utilization of these organisms could be promoted via the combined use of them and the ecological regulation of the agricultural landscape, so as to ensure the high-quality development of Chinese solanaceous crop industry.
Community Analysis of Nematodes Associated with Banana, Identification of root knot nematode and Evaluation the Susceptibility of Some Cultivars to Infection

Radwa G. Mostafa,Aida M. El-Zawahry,Ashraf E. M. Khalil,Ameer E. Elfarash,Ali D. A. Allam

DOI: https://doi.org/10.21203/rs.3.rs-740928/v1

2021-08-04

Abstract:Abstract Background Plant-parasitic nematodes are extremely dangerous pests in a variety of economically important crops. The purpose of this study was a survey of all nematode species existing in banana from three sites in Assiut Governorate, Egypt and to characterize the most common species by morphological, morphometric and molecular techniques (PCR with species-specific primers). Then, study of resistance or sensitivity of some banana cultivars to root-knot nematodes. Methods and Results Four nematodes, Meloidogyne , Rotylenchulus reniformis , Helicotylenchus and Pratylenchus were isolated and identified from soil and root samples collected from banana plants. Most frequently occurring of plant parasitic nematode species in banana was Meloidogyne . Former research found differences in species and in resistance to root-knot nematodes among the examined plant cultivars. Identification of Root-knot nematodes by Characterize of morphometric, molecularly, morphological isolate of Meloidogyne related to banana plants. The results revealed that the identified nematode species, Meloidogyne javanica , is the most common plant-parasitic nematodes in all locations. Data on the susceptibility of the tested banana cultivars to M. javanica revealed that Grand Naine was highly susceptible (HS) however, Magraby was susceptible (S) but Williams and Hindi cultivars were moderately resistant (MR). Conclusions we concluded that a survey revealed the significant prevalence of Meloidogyne javanica , the most important nematodes on banana in Assiut. The morphometric, morphological, and molecular identification were harmonic with one another. In addition to the host response of certain banana cultivars, to M. javanica that resistance is of significance and can be helpful to incorporate through planning control measures for root- knot nematodes.
Advances in fundamental and applied studies in China of fungal biocontrol agents for use against arthropod pests

chengshu wang,mingguang feng

DOI: https://doi.org/10.1016/j.biocontrol.2013.06.017

IF: 3.857

2014-01-01

Biological Control

Abstract:•Biocontrol potential of entomopathogenic fungi depends on fungal virulence and field adaptation.•Genetic improvement of fungal biocontrol potential needs new knowledge in genomics and molecular biology.•Genomic and molecular studies in China speed up for creating new-generation mycoinsecticides.
Biological control of the native endophytic fungus Pochonia chlamydosporia from the root nodule of Dolichos lablab on Fusarium wilt of banana TR4

Yunfan Zhou,Limei Yang,Shengtao Xu,Shu Li,Li Zeng,Hui Shang,Xundong Li,Huacai Fan,Si-Jun Zheng

DOI: https://doi.org/10.3389/fmicb.2024.1371336

IF: 5.2

2024-03-28

Frontiers in Microbiology

Abstract:Fusarium wilt of banana caused by Fusarium oxysporum f. sp. cubense , Tropical Race 4 (TR4) is a soil-borne disease, and it is devastating. At present, the biological control using antagonistic microorganisms to mitigate TR4 is one of the best strategies as a safe and green way. Yunnan has abundant and diverse microbial resources. Using the dual-culture method, the antagonistic endophytic fungi against TR4 were isolated and screened from the root nodule of Dolichos lablab . The effect of the highest antagonistic activity strain on the morphology of the TR4 mycelium was observed using the scanning electron microscope. According to morphological characteristics and sequence analysis, the strain was identified. The biocontrol effect and plant growth promotion were investigated by greenhouse pot experiment. Using the confocal laser scanning microscope and the real-time fluorescence quantitative PCR, the dynamics of TR4 infestation and the TR4 content in banana plant roots and corms would also be detected. In this study, 18 native endophytic fungi were isolated from a root nodule sample of Dolichos lablab in the mulch for banana fields in Yuxi, Yunnan Province, China. The YNF2217 strain showed a high antagonistic activity against TR4 in plate confrontation experiments, and the inhibition rate of YNF2217 is 77.63%. After TR4 culture with YNF2217 for 7 days in plate confrontation experiments, the morphology of the TR4 mycelium appeared deformed and swollen when observed under a scanning electron microscope. According to morphological characteristics and sequence analysis, the strain YNF2217 was identified as Pochonia chlamydosporia . In the greenhouse pot experiment, the biocontrol effect of YNF2217 fermentation solution on TR4 was 70.97% and 96.87% on banana plant leaves and corms, respectively. Furthermore, YNF2217 significantly promoted the growth of banana plants, such as plant height, leaf length, leaf width, leaf number, pseudostem girth, and both the aboveground and underground fresh weight. Observations of TR4 infestation dynamics in banana roots and corms, along with real-time fluorescence quantitative PCR, verified that YNF2217 inoculation could significantly reduce the TR4 content. Therefore, YNF2217 as P. chlamydosporia , which was found first time in China and reported here, is expected to be an important new fungal resource for the green control of Fusarium wilt of banana in the future.

microbiology
Microbes vs. Nematodes: Insights into Biocontrol through Antagonistic Organisms to Control Root-Knot Nematodes

Adil Ameen Bhat,Adnan Shakeel,Sonia Waqar,Zafar Ahmad Handoo,Abrar Ahmed Khan

DOI: https://doi.org/10.3390/plants12030451

2023-01-19

Plants

Abstract:Root-knot nematodes (Meloidogyne spp.) are sedentary endoparasites that cause severe economic losses to agricultural crops globally. Due to the regulations of the European Union on the application of nematicides, it is crucial now to discover eco-friendly control strategies for nematode management. Biocontrol is one such safe and reliable method for managing these polyphagous nematodes. Biocontrol agents not only control these parasitic nematodes but also improve plant growth and induce systemic resistance in plants against a variety of biotic stresses. A wide range of organisms such as bacteria, fungi, viruses, and protozoans live in their natural mode as nematode antagonists. Various review articles have discussed the role of biocontrol in nematode management in general, but a specific review on biocontrol of root-knot nematodes is not available in detail. This review, therefore, focuses on the biocontrol of root-knot nematodes by discussing their important known antagonists, modes of action, and interactions.

plant sciences
Unraveling the enigma of root-knot nematodes: from origins to advanced management strategies in agriculture

Sumit Vashisth,Pankaj Kumar,Vishav Gaurav Singh Chandel,Rakesh Kumar,Subhash Chander Verma,Rajeshwar Singh Chandel

DOI: https://doi.org/10.1007/s00425-024-04464-5

IF: 4.54

2024-06-27

Planta

Abstract:Integrated management strategies, including novel nematicides and resilient cultivars, offer sustainable solutions to combat root-knot nematodes, crucial for safeguarding global agriculture against persistent threats.

plant sciences
Advances in the research on invasive insects in China

Dan-Dan XU,Li CHEN,Xiao-Wei WANG,Min LU

DOI: https://doi.org/10.7679/j.issn.2095-1353.2017.106

2017-01-01

Abstract:With the rapid development of economic globalization, invasive species have become a far-reaching global issue. Impacts of invasive insects on agriculture, forestry, ecology, socio-economy and human health are becoming increasingly serious and cause for concern. In this paper, we introduce advances in theoretical and applied research on 14 invasive insects in China and summarize novel theory, methods and recent progress. Perspectives and directions for future research on invasive insects are discussed. The results provide new insights for the early warning, prevention, detection, monitoring, management, and control, of invasive insects.
Protective role of native root-associated bacterial consortium against root-knot nematode infection in susceptible plants

Shikai La,Jiafan Li,Si Ma,Xingqun Liu,Lihong Gao,Yongqiang Tian

DOI: https://doi.org/10.1038/s41467-024-51073-7

2024-08-07

Abstract:Root-knot nematodes (RKNs) are a global menace to agricultural crop production. The role of root-associated microbes (RAMs) in plant protection against RKN infection remains unclear. Here we observe that cucumber (highly susceptible to Meloidogyne incognita) exhibits a consistently lower susceptibility to M. incognita in the presence of native RAMs in three distinct soils. Nematode infection alters the assembly of bacterial RAMs along the life cycle of M. incognita. Particularly, the loss of bacterial diversity of RAMs exacerbates plant susceptibility to M. incognita. A diverse range of native bacterial strains isolated from M. incognita-infected roots has nematode-antagonistic activity. Increasing the number of native bacterial strains causes decreasing nematode infection, which is lowest when six or more bacterial strains are present. Multiple simplified synthetic communities consisting of six bacterial strains show pronounced inhibitory effects on M. incognita infection in plants. These inhibitory effects are underpinned via multiple mechanisms including direct inhibition of infection, secretion of anti-nematode substances, and regulation of plant defense responses. This study highlights the role of native bacterial RAMs in plant resistance against RKNs and provides a useful insight into the development of a sustainable way to protect susceptible plants.
Biocontrol potential of Bacillus altitudinis AMCC1040 against root-knot nematode disease of ginger and its impact on rhizosphere microbial community

Jian-Yu Wang,Cheng Guo,Peng Zhao,Feng-Yuan Yu,Yue Su,Jian-Ping Qu,Jia-Long Wang,Rong-Shan Lin,Bing Wang,Zheng Gao,Zheng-You Yang,Bo Zhou

DOI: https://doi.org/10.1016/j.biocontrol.2021.104598

IF: 3.857

2021-07-01

Biological Control

Abstract:Root knot nematodes are one of the most destructive hemibiotrophic root pathogens that can cause ginger bark cracking disease in ginger planting areas around the world. There is an urgent need for sustainable alternatives methods, such as biological control. The nematicidal activity of Bacillus altitudinis AMCC1040 has been previously shown in vitro and in pot experiments. Here, field experiments were conducted to evaluate the biocontrol potential of Bacillus altitudinis AMCC1040 against ginger bark cracking disease, and to evaluate its ability to colonize the rhizosphere. In addition, we also evaluated its impact on the rhizosphere microbial communities. The results of biocontrol experiments demonstrated that the application of Bacillus altitudinis AMCC1040 can significantly inhibit nematode reproduction, inhibit root galling and reduce the severity of ginger bark cracking disease. In addition, Bacillus altitudinis AMCC1040 colonized steadily in ginger rhizosphere soil ranging from 5.08 to 5.49 Log10 CFU g-1 soils. Compared with fosthiazate (One of the most commonly used nematicides in China), Bacillus altitudinis AMCC1040 performed better in terms of bio-safety. Meanwhile, the taxa enriched in Bacillus altitudinis AMCC1040 treatment were found in Actinobacteria, Gemmatimonadetes and Firmicutes. This study demonstrated that Bacillus altitudinis AMCC1040 have a strong potential to control ginger bark cracking disease in the field. These results provide strong support for further exploration of the application of Bacillus spp. as biocontrol agents to control root knot nematodes in many crops. Furthermore, the occurrence of ginger bark cracking disease described in this study will be of great help to future prevention and control measures.

biotechnology & applied microbiology,entomology

Advances in Banana Root Knot Nematode in China

Research Advances in Tomato Root Knot Nematode Disease

Advances of Studies on Biological Control of Vegetable Root-knot Nematode in Installation Cultivation

Approaches and Advances on the Classification and Identification of Root Knot Nematode

Morphological identification of two root-knot nematode species occurring in vegetable crops of Zhejiang,China

Recent Advances in Molecular Biology Research of a Rice Pest, the Brown Planthopper

Morphological and Molecular Characterization of the Rice Root-Knot Nematode, Meloidogyne Graminicola, Golden and Birchfeild, 1965 Occurring in Zhejiang, China

Recent research progress of soil nematode ecology in China

Morphological identification and description of three rice root nematodes occurring in China

Field Efficacy Trail of Different Nematicides on Controlling Cucumber Root Knot Nematodes

Heterodera koreana,a new record of cyst-forming nematodes in Zhejiang Province,China

Investigation of Root-knot Nematodes in East China

Research progress on biological control of Tuta absoluta (Meyrick)

Community Analysis of Nematodes Associated with Banana, Identification of root knot nematode and Evaluation the Susceptibility of Some Cultivars to Infection

Advances in fundamental and applied studies in China of fungal biocontrol agents for use against arthropod pests

Biological control of the native endophytic fungus Pochonia chlamydosporia from the root nodule of Dolichos lablab on Fusarium wilt of banana TR4

Microbes vs. Nematodes: Insights into Biocontrol through Antagonistic Organisms to Control Root-Knot Nematodes

Unraveling the enigma of root-knot nematodes: from origins to advanced management strategies in agriculture

Advances in the research on invasive insects in China

Protective role of native root-associated bacterial consortium against root-knot nematode infection in susceptible plants

Biocontrol potential of Bacillus altitudinis AMCC1040 against root-knot nematode disease of ginger and its impact on rhizosphere microbial community