Heterodera koreana,a new record of cyst-forming nematodes in Zhejiang Province,China
Hongxue ZHU,Zhongling TIAN,Ruihang CAI,Xiaolin LI,Jingwu ZHENG
DOI: https://doi.org/10.3785/j.issn.1008-9209.2016.10.071
2017-01-01
Abstract:Cyst-forming nematode is an important plant parasitic nematode group,in which over 80 species were reported and described.There are many economically important cyst-forming nematodes species in China,such as Heterodera glycines,Heterodera avenae,and Heterodera filipjevii.During 2015—2016,a survey for cyst-forming nematodes in Zhejiang,eastern China,revealed the distribution of a cyst-forming nematode population from Phyllostachys praecox in Lin'an,Zhejiang,eastern China.Morphological characteristics and morphometrics of cysts and second-stage juveniles (J2s)were observed and measured using light microscope and scanning electron microscope.Cysts were characterized by appearing light to dark brown in coloration,globose to subspherical shape of body contour,distinct neck and cone,lacking underbridge,bullae and fenestrae,body length ranging from 575.0 to 1230.0μm,body width ranging from 397.0 to 872.0μm,and vulva slit length ranging from 36.7 to 50.9μm.J2 was characterized by hemispherical labial region,nearly continuous with round body contour and stylet knobs,three incisures in lateral field,tail tapering and tail hyaline region accounting for 55% 75%,body length ranging from 426.3 to 608.0μm;body width ranging from 15.9 to 29.3μm;stylet length ranging from 17.7 to 21.9μm;dorsal gland orifice ranging from 4.3 to 6.2μm;tail length ranging from 68.7 to 84.5μm.Amplification of the ITS and D2/D3 fragments of the cyst-forming nematodes from bamboo with universal primers AB28 (ATATGCTTAAGTTCAGCGGGT)and TW81 (GTTTCCGTAGGTGAACCTGC),D2 A (ACAAGTACCGTGA GGGAAAGTTG)and D3B (TCGGAAGGAACCAGCTACTA)yielded PCR fragments with sizes of 1006 bp (GenBank:KX640828)and 786 bp (GenBank:KX640827),respectively,the sequences of ITS and D2/D3 of cyst nematodes parasitizing on bamboo were 99.7% and 99.6% similar to that of Heterodera koreana deposited in GenBank,respectively.Combined with morphological, morphometrics and molecular phylogeny analysis, the results showed that the cyst nematodes parasitizing on bamboo from Lin'an,Zhejiang,China is H.koreana,is a new record in Zhej iang,Eastern China.