Abstract:Genome editing technologies enable precise modifications of DNA sequences in vivo and offer great promise for crop improvement. CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated Cas9) has revolutionized genome editing because of its simplicity and versatility (Cong et al., 2013Cong L. Ran F.A. Cox D. Lin S. Barretto R. Habib N. Hsu P.D. Wu X. Jiang W. Marraffini L.A. et al.Multiplex genome engineering using CRISPR/Cas systems.Science. 2013; 339: 819-823Crossref PubMed Scopus (9981) Google Scholar). However, the majority of the editing events reported in plants were through error-prone non-homologous end joining (NHEJ) to generate mutations and gene knockouts (Miao et al., 2013Miao J. Guo D. Zhang J. Huang Q. Qin G. Zhang X. Wan J. Gu H. Qu L.J. Targeted mutagenesis in rice using CRISPR-Cas system.Cell Res. 2013; 23: 1233-1236Crossref PubMed Scopus (585) Google Scholar, Voytas and Gao, 2014Voytas D.F. Gao C. Precision genome engineering and agriculture: opportunities and regulatory challenges.PLoS Biol. 2014; 12: e1001877Crossref PubMed Scopus (279) Google Scholar, Xie et al., 2014Xie K. Zhang J. Yang Y.N. Genome-wide prediction of highly specific guide RNA spacers for CRISPR-Cas9-mediated genome editing in model plants and major crops.Mol. Plant. 2014; 7: 923-926Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar, Ma et al., 2015Ma X. Zhang Q. Zhu Q. Liu W. Chen Y. Qiu R. Wang B. Yang Z. Li H. Lin Y. et al.A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants.Mol. Plant. 2015; 8: 1274-1284Abstract Full Text Full Text PDF PubMed Scopus (1160) Google Scholar). While complete knockouts and loss-of-function mutations are very valuable in defining gene functions, their applications in crop improvement are somewhat limited because many agriculturally important traits are conferred by point mutations or change of gene expression levels. Development of a technique that enables gene replacement rather than gene inactivation will greatly facilitate plant breeding (Weeks et al., 2016Weeks D.P. Spalding M.H. Yang B. Use of designer nucleases for targeted gene and genome editing in plants.Plant Biotechnol. J. 2016; 14: 483-495Crossref PubMed Scopus (157) Google Scholar). Homology-directed repair (HDR) after CRSIPR/Cas9 that generates double-stranded breaks (DSB) at specific locations can potentially provide a feasible approach to achieve gene replacement. However, it has been very challenging to use HDR in plants because the frequency of targeted integration by HDR remains much lower than that of NHEJ (Puchta, 2005Puchta H. The repair of double-strand breaks in plants: mechanisms and consequences for genome evolution.J. Exp. Bot. 2005; 56: 1-14Crossref PubMed Google Scholar). Another major obstacle in HDR in plants is the delivery of repair templates. Recently, particle bombardment was employed to deliver Cas9/gRNA and repair templates simultaneously into soybean and maize in attempts to achieve HDR-mediated targeted gene replacement. It was reported that a P178S mutation in the Acetolactate Synthase 1 (ALS1), a key enzyme for the biosynthesis of branched chain amino acids and a major target for important herbicides including chlorsulfuron and bispyribac sodium (BS) (Mazur et al., 1987Mazur B.J. Chui C.F. Smith J.K. Isolation and characterization of plant genes coding for acetolactate synthase, the target enzyme for two classes of herbicides.Plant Physiol. 1987; 85: 1110-1117Crossref PubMed Google Scholar), was successfully introduced in soybean through CRISPR/Cas9-mediated gene editing. But such strategy only resulted in one chlorsulfuron-resistant callus event (Li et al., 2015Li Z. Liu Z.B. Xing A. Moon B.P. Koellhoffer J.P. Huang L. Ward R.T. Clifton E. Falco S.C. Cigan A.M. Cas9-guide RNA directed genome editing in soybean.Plant Physiol. 2015; 169: 960-970Crossref PubMed Scopus (295) Google Scholar). Substitution of P165 with Ser in the ALS2 in maize using either single-stranded oligonucleotides or double-stranded DNA vectors as repair templates yielded chlorsulfuron-resistant maize plants (Svitashev et al., 2015Svitashev S. Young J.K. Schwartz C. Gao H. Falco S.C. Cigan A.M. Targeted mutagenesis, precise gene editing, and site-specific gene insertion in maize using Cas9 and guide RNA.Plant Physiol. 2015; 169: 931-945Crossref PubMed Scopus (449) Google Scholar). It is not clear whether similar strategies will work in other plant species including Arabidopsis and rice. Furthermore, it is important to investigate whether multiple discrete point mutations can be simultaneously introduced into plant genes through CRISPR/Cas9-mediated gene editing. In this study, we report an efficient method to introduce multiple discrete point mutations in the rice ALS gene using CRISPR/Cas9-mediated homologous recombination. We first used single-stranded oligonucleotides as repair templates, which were successful in maize. We co-transformed the rice calli with either pCXUN-Cas9-gRNA1 and the W548L oligonucleotide donor, or pCXUN-Cas9-gRNA2 and the S627I oligonucleotide donor, through particle bombardment (Supplemental Figure 1). Among the 480 calli bombarded, only one had the W548L HDR event and none with the edited ALS was recovered, demonstrating that this strategy works much less efficiently in rice than that reported in maize (Svitashev et al., 2015Svitashev S. Young J.K. Schwartz C. Gao H. Falco S.C. Cigan A.M. Targeted mutagenesis, precise gene editing, and site-specific gene insertion in maize using Cas9 and guide RNA.Plant Physiol. 2015; 169: 931-945Crossref PubMed Scopus (449) Google Scholar). We then decided to use two gRNAs instead of one gRNA and a repair template in an attempt to simultaneously substitute two amino acid residues (W548 to L and S627 to I) in rice ALS (Figure 1A ). We designed a plasmid that harbors cassettes expressing Cas9 and two gRNAs (Figure 1A and 1B). In addition, the plasmid contained a donor fragment was designed as a template for HDR (Figure 1B). Cas9 was under the control of the maize ubiquitin promoter and both gRNAs were driven by the rice U3 promoter (Figure 1B). The two gRNAs were located at opposite strands of the two targeting sites (target 1 and target 2) (Figure 1B). The 476-bp donor fragment contained several features (Figure 1B and Supplemental Figure 2). Firstly, the fragment contained the desired mutations (W548L and S627I substitutions) in the middle of the 264-bp core sequence of the donor fragment, which corresponded to the region (1625–1888 bp) of the wild-type ALS gene. Secondly, the donor fragment had several synonymous substitutions that would not change amino acid residues, but could prevent Cas9 from cutting the donor fragment again once HDR was successfully achieved. Thirdly, this 264-bp core sequence in the donor fragment was flanked with the 100-bp left arm and the 46-bp right arm, which were identical to the stretches of ALS sequences. The two arms were then flanked with two gRNA target sequences including the PAM motifs, respectively, so that the donor DNA can be released by Cas9/gRNAs. Moreover, an EcoRV restriction site between the two gRNA targeting sites in the donor fragment was mutated as a diagnostic marker for HDR events (Figure 1B and Supplemental Figure 2). In order to provide enough donor fragments for HDR, the free 476-bp double-stranded DNA donor fragment and the plasmid were co-introduced into rice (Japonica cv. Nipponbare) calli through particle bombardment. Among 320 calli bombarded, 116 independent lines survived the selection pressure of both hygromycin and BS. Among these lines, 52 were randomly selected for further analysis. PCR primer set 753F/R was designed to amplify an ALS fragment from both the wild-type ALS locus and the edited ALS, but not from the plasmid (Figure 1C). As shown in Figure 1C and Supplemental Table 1, EcoRV failed to cut the PCR products from all of the lines except for a few lines, which actually produced four bands after the EcoRV digestion, while wild-type DNA would only produce two bands (Figure 1C), indicating that most of the generated plants underwent HDR. Sequencing results showed that CRISPR/Cas9-mediated HDR occurred in all the plants analyzed. However, the lines with four EcoRV-digested bands had different HDR events (Figure 1C–1F and Supplemental Table 1). For all the lines analyzed, W548 was successfully changed into L in ALS as designed, and only one type of recombination event was observed at this locus and was designated as HDR548 (Figure 1D and 1F). But for the S627 locus, three different haplotypes of HDR (HDR627-1, HDR627-2, and HDR627-3) were observed (Figure 1D and 1F). Whereas HDR627-1 was exactly the same as the designed sequence, HDR627-2 and HDR627-3 were slightly different from the designed donor core sequence with one or two SNPs identical to the wild-type ALS gene (Figure 1F). For batch B97, all lines had the HDR627-1 genotype (Supplemental Table 1). In contrast, all lines produced in batch B98 had the HDR627-3 genotype (Supplemental Table 1). Interestingly, the 24 lines produced in batch B99 contained all three HDR haplotypes at the S627 locus. The other four- lines derived from batch B99 showed a different HDR genotype (Supplemental Table 1). They were bi-allelic variations: one allele had HDR548, while no HDR occurred at the S627 locus and EcoRV site in one DNA strand (B99-12–39). If this allele was used as a template, the EcoRV-digested PCR fragment amplified by using 753F/R primers would generate 488-bp and 265-bp fragments. Another allele resulted from NHEJ at both target 1 and target 2, with the sequence between the two target sites replaced by its reverse-complemented wild-type sequences (Figure 1E and Supplemental Table 1). EcoRV digestion of the PCR fragment using this allele as a template generated fragments of 424-bp and 331-bp because the distance from the EcoRV restriction site to the location of the primer had changed after integration of the reverse-complemented wild-type sequences at this locus (Figure 1C and 1E). Overall, the bi-allelic plants would generate four EcoRV bands. We also delivered the pCXUN-Cas9-gRNA1-gRNA2-armed donor vector (Figure 1B) into rice calli through Agrobacterium infection. Among 240 calli used for infection, 80 independent lines were obtained and 40 lines were randomly selected for further analysis. PCR/RE assays indicated that no homozygous HDR line was obtained, whereas 30 lines were heterozygous and the other 10 lines were wild-types. Sequencing results indicated that HDR event occurred only in one strand with HDR types of HDR548 and HDR627-1 (Figure 1F); whereas NHEJ occurred in the other strand between the two gRNA targeting sites in all 30 heterozygous lines investigated (Supplemental Table 1). Combining the results of co-bombardment of both the vector donor and free donor fragments that generated 48 homozygous lines in the T0 population among the 52 lines investigated, we believe that the strategy of using two sources of DNA repair templates simultaneously increased HDR efficiency in rice. To determine whether the plants with edited ALS had gained herbicide resistance, we sprayed both the non-transformed wild-type plants derived from tissue culture without selection and plants containing the edited ALS gene with 100 μM BS at the five-leaf stage. Ten days after the spray, new leaves of the wild-type rice plants became withered, whereas the edited plants behaved normally. After 36 days, the wild-type rice plants died, whereas the plants with the modified ALS locus exhibited tolerance to BS and grew normally (Figure 1G). In conclusion, the previously reported strategy using single-stranded oligos as repair templates did not yield edited rice plants as designed in this study, suggesting that a successful strategy in one plant species needs to be modified for other plant species. Our strategy of using two gRNAs and providing repair templates from both the plasmid and free double-stranded DNAs worked efficiently in precisely substituting two discrete amino acid residues in the ALS through particle bombardment.Thus, an agriculturally important trait in rice was successfully introduced. We not only generated homozygous herbicide-resistant rice plants in one generation but also demonstrated that the strategy using the CRISPR/Cas9 system presented here is feasible and effective in precise gene replacement and thus might facilitate crop genetic improvement. This work is supported by grants from the Chinese Ministry of Agriculture (grant no. 2016ZX08010003, 2016ZX010-2, 2014ZX08010003) and a startup from the Huazhong Agricultural University.

Abstract:Plant Biotechnology JournalVolume 15, Issue 11 p. 1371-1373 LetterOpen Access CRISPR-S: an active interference element for a rapid and inexpensive selection of genome-edited, transgene-free rice plants Hai-Ping Lu, Hai-Ping Lu National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorSong-Mei Liu, Song-Mei Liu National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorShou-Ling Xu, Shou-Ling Xu Institute of Nuclear Agricultural Sciences, Zhejiang University, Hangzhou, ChinaSearch for more papers by this authorWu-Yang Chen, Wu-Yang Chen National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorXin Zhou, Xin Zhou National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, ChinaSearch for more papers by this authorYuan-Yuan Tan, Yuan-Yuan Tan National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorJian-Zhong Huang, Jian-Zhong Huang Institute of Nuclear Agricultural Sciences, Zhejiang University, Hangzhou, ChinaSearch for more papers by this authorQing-Yao Shu, Corresponding Author Qing-Yao Shu qyshu@zju.edu.cn National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaCorrespondence (Tel (+86)-571-86971405; fax (+86)-571-86971405; email qyshu@zju.edu.cn)Search for more papers by this author Hai-Ping Lu, Hai-Ping Lu National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorSong-Mei Liu, Song-Mei Liu National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorShou-Ling Xu, Shou-Ling Xu Institute of Nuclear Agricultural Sciences, Zhejiang University, Hangzhou, ChinaSearch for more papers by this authorWu-Yang Chen, Wu-Yang Chen National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorXin Zhou, Xin Zhou National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, ChinaSearch for more papers by this authorYuan-Yuan Tan, Yuan-Yuan Tan National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorJian-Zhong Huang, Jian-Zhong Huang Institute of Nuclear Agricultural Sciences, Zhejiang University, Hangzhou, ChinaSearch for more papers by this authorQing-Yao Shu, Corresponding Author Qing-Yao Shu qyshu@zju.edu.cn National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaCorrespondence (Tel (+86)-571-86971405; fax (+86)-571-86971405; email qyshu@zju.edu.cn)Search for more papers by this author First published: 08 July 2017 https://doi.org/10.1111/pbi.12788Citations: 60AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat Dear Editor, The CRISPR/Cas9-based genome-editing tool has been used in diverse applications related to plant research, including for crop improvement (Liu et al., 2017; Sun et al., 2016). Mutant plants may be generated via transient transformations or DNA-free editing (Liang et al., 2017). However, plant genomes are often edited during the production of transgenic plants, in a process that involves the identification of targeted edits in regenerated T0 plants and the subsequent elimination of transgenes in T1 plants (Sun et al., 2016). Because T-DNA (e.g. CRISPR/Cas9) is randomly inserted into plant genomes, it may be silent (e.g. when incorporated in heterochromatin) or is actively silenced; hence, theoretically only a portion of the T0 plants carry active transgenes, although high genome-editing rates have been observed (Xie et al., 2015). Therefore, selecting transgene-free plants with an edited genome may be a time-consuming and costly part of genome-editing projects. This is especially true for practical breeding programmes when many plants need to be produced and screened, considering that successful application is often genotype dependent (Zhu et al., 2017). The RNA interference (RNAi) technique has already been used to decrease the abundance of unwanted grain ingredients or increase resistance to viral pathogens (Kamthan et al., 2015). Functional RNAi elements (e.g. hairpin RNAi, hpRNAi) can be detected in T0 plants because of their dominant nature. Therefore, we hypothesized that when an RNAi expression element is incorporated into a CRISPR/Cas9 vector, the activity and presence of the T-DNA in the transgenic plants can be monitored based on RNAi. This would enable a PCR-free, phenotype-based identification of genome-edited T0 plants, and a subsequent selection of transgene-free T1 plants. In rice, CYP81A6 encodes a P450 cytochrome protein that confers resistance to bentazon. Silencing CYP81A6 may render rice plants susceptible to the herbicide (Pan et al., 2006). We speculated that a CYP81A6-hpRNAi may be a suitable marker for CRISPR/Cas9 expression. To produce a CYP81A6-hpRNAi element, we first amplified a 300-bp fragment from CYP81A6 using forward (5′AGCTTAGCCATGGATAACGCCTAC3′) and reverse (5′AAGGTCACGTCGTGCTCGGTGAAGCACTC3′) primers. The fragment was then inserted into the pBSSK-IN vector to form a hairpin structure, which was then introduced into a pCAMBIA-1300 vector between the double 35S (d35S) promoter and the Nos terminator (nos). We inserted the d35S-hpRNAi-nos element into the HpaI site near the left border of a CRISPR/Cas9 vector, pHun4c12, to construct a new CRISPR/Cas9 vector, pHun4c12s (Figure 1a). To test the utility of pHun4c12s, we constructed another CRISPR/Cas9 expression vector, pHun4c12s-lct1, to target OsLCT1, which encodes a Cd transporter (Uraguchi et al., 2011). Ninety-six independent transgenic T0 plants were generated via Agrobacterium tumefaciens-mediated transformation of japonica rice genotype Xidao #1 cells with pHun4c12s-lct1 and analysed further. Figure 1Open in figure viewerPowerPoint Production of genome-edited, transgene-free rice plants. (a) Diagram of a CRISPR-S vector, pHun4c12s, derived from pHun4c12. (b) Bentazon-resistant (left, T0-R) and bentazon-susceptible (right, T0-S) tillers of transgenic T0 plants. (c) and (d) Box plot representations of Cas9 (c) and CYP81A6 (d) relative transcript levels of T0-S and T0-R plants. The values of one arbitrarily chosen T0-R plant (c) and one T0-S plant (d) were set as 1. For each box plot, the 10th, 25th, median, 75th and 90th percentiles of relative transcript levels were represented by horizontal lines (bottom to top), the average as filled circles, and the minimum and maximum indicated by empty triangles. (e) Illustration of the genetics of genome editing, bentazon susceptibility, and segregation of transgene and genome edits. In transgene-expressing T0 plants, the target gene (empty circle) is edited by the CAS9 and sgRNA complex to introduce mutations (filled circle). Meanwhile, CYP81A6-hpRNAi degrades CYP81A6 transcripts, rendering plants susceptible to bentazon. In contrast, the genomes of T0 plants with a silenced transgene are not edited, and these plants remain resistant to bentazon. Transgene-free (i.e. resistant to bentazon), genome-edited T1-R plants are produced by bentazon treatment, which kills transgenic T1-S plants. (f) Symptoms of Line #2 T1 seedlings 1 week after a bentazon foliar spray (1000 mg/L). (g) Segregation of bentazon-susceptible (filled) and bentazon-resistant (empty) plants in 16 T1 lines. Lines fit the 3:1 or 16:1 ratios based on a chi-square test are indicated with triangles or squares, respectively. Line #19 T1 plants are indicated with a filled star. (h) T-DNA copy number in Line #19 plants assessed by a qRT-PCR analysis of Cas9, with Actin as the internal standard, and the value of Line #2 T0 plant set as 1. Actin was used as the internal standard in qRT-PCR analysis. First, we tested the susceptibility of the T0 plants to bentazon using a foliar spray. Tillers of T0 plants were separated and grown as two subplants. One normally growing subplant of each T0 plant was treated with a bentazon solution (2000 mg/L) by spraying until droplets were visible on leaves. About 1 week later, 29 T0 subplants appeared to be susceptible and eventually died (T0-S plants; Figure 1b). The other 67 T0 plants were not visibly affected (T0-R plants). Second, we sequenced the OsLCT1 target region of the T0 plants. All 29 T0-S plants were affected by homozygous (aa), biallelic (aa′) or heterozygous (Aa) mutations in the target region. Mutations were not detected in the remaining plants. Thus, bentazon susceptibility was 100% correlated with the targeted mutations in T0 plants. Third, we analysed the abundance of Cas9 and CYP81A6 transcripts in T0-R and T0-S plants using a quantitative real-time PCR (qRT-PCR). Overall, the Cas9 transcript was significantly more abundant in T0-S plants than in T0-R plants (Figure 1c). In contrast, the abundance of the CYP81A6 transcript was lowest in the T0-S plants (Figure 1d), suggesting that CYP81A6-hpRNAi was more highly expressed in these plants. The expression of CYP81A6-hpRNAi resulted in the degradation of CYP81A6 transcripts via RNAi in transgene-expressing, T0-S plants. In contrast, the transgene-silenced T0 plants remained resistant to bentazon (Figure 1e). These observations imply that CYP81A6-hpRNAi enables the efficient selection of genome-edited T0 plants. Our system was also designed to simplify the selection of transgene-free T1 plants. We grew 72 seedlings for each of 16 T1 lines derived from homozygous or biallelic OsLCT1 mutant T0 plants treated them with 1000 mg/L bentazon in a foliar spray (approximately 100 mL/m2) at around the four-leaf stage. About 4 days later, we observed that all Xidao #1 seedlings were growing normally, but some of the T1 seedlings started dehydrating and eventually died (Figure 1f). Furthermore, we proved that all bentazon-susceptible plants were transgenic, while all bentazon-resistant plants lacked T-DNA. The segregation of T1 plants derived from a homozygous or biallelic genome-edited T0 plant is presented in Figure 1e, in which the genome-edited, transgene-free plants are resistant to bentazon because the CYP81A6-hpRNAi no longer exists. Meanwhile, transgenic plants are susceptible because the CYP81A6 transcripts are degraded. Transgenic plants produced by A. tumefaciens-mediated transformation often carry one or two copies of T-DNA (Collier et al., 2017). The segregation ratio observed for bentazon susceptibility was consistent with this fact in all T1 lines except for Line #19 (Figure 1g). All Line #19 T1 seedlings were susceptible to bentazon and died. Based on the 3:1 segregation ratio of its T1 population (Figure 1g), the Line #2 T0 plant was expected to have a single T-DNA insertion and was therefore used as the control for the qRT-PCR analysis. The Line #19 T0 plant and its T1 progenies appeared to have the same T-DNA copy number, and they all had double the number of insertions of the Line #2 T0 plant (Figure 1h). This implies that T-DNA copies were incorporated into sister chromosomes in Line #19 T0 plant. Otherwise, variability in the T-DNA copy numbers among the T1 plants would have been detected. To test the utility of CRISPR-S for other genes, we constructed a pHun4c12s-frg vector to target OsBADH2 (Bradbury et al., 2005). We transformed nine rice genotypes and obtained 4–22 T0 plants for each genotype. All T0 plants susceptible to bentazon were confirmed to carry mutations. Similarly, transgene-free, OsBADH2-edited T1 plants were identified following a bentazon treatment of T1 seedlings. The results of our proof-of-concept study revealed that the Cas9 expression level could be indirectly estimated using a marker trait generated by an RNAi element incorporated into the CRISPR/Cas9 expression vector. This new CRISPR/Cas9 system provides a relatively simple way of identifying and eliminating T0 plants in which the genome has not been edited. More importantly, our method enables the selection of transgene-free T1 plants, with almost no cost, confirming the value of this system. Antibiotic or herbicide resistance genes in binary vectors are important for selecting transgenic plants. However, they cannot be directly used to select transgene-free T1 plants because they would kill the plants. Seed-localized fluorescent reporters have been used to discriminate between transgenic and nontransgenic seeds in a few plant species. Unfortunately, they are unsuitable for species that produce seeds with hulls or glumes such as rice. Although our system has been demonstrated in rice, it may be possible to develop similar systems in other plant species. Highly conserved homologs of CYP81A6 have been detected in monocots. Thus, the bentazon-susceptibility trait may also be used in these plant species. Furthermore, other suitable marker traits can be generated by down-regulating the expression of other genes to introduce visible morphological changes to leaf shape and colour, among other characteristics. Funding This work was supported by the Zhejiang Provincial S & T Project on Breeding of Agricultural (Food) Crops (grant no. 2016C02050-2). Author Contributions Q.-Y. S., H.-P. L. and J.-Z. H designed the experiments, analysed the data and wrote the manuscript; H.-P. L. conducted the experiments with the assistance of S.-M. L., S.-L. X., W.-Y. C., X. Z. and Y.-Y. T. Acknowledgments We thank Dr. Pengcheng Wei for providing the original CRISPR/Cas9 vector (pHun4c12). The authors have no conflicts of interest to declare. References Bradbury, L., Fitzgerald, T., Henry, R., Jin, Q. and Waters, D. (2005) The gene for fragrance in rice. Plant Biot. J. 3, 363– 370. Collier, R., Dasgupta, K., Xing, Y.P., Hernandez, B.T., Shao, M., Rohozinski, D., Kovak, E. et al. (2017) Accurate measurement of transgene copy number in crop plants using droplet digital PCR. Plant J. 90, 1014– 1025 https://doi.org/10.1111/tpj.13517. Kamthan, A., Chaudhuri, A., Kamthan, M. and Datta, A. (2015) Small RNAs in plants: recent development and application for crop improvement. Front. Plant Sci. 6, 208. Liang, Z., Chen, K.L., Li, T.D., Zhang, Y., Wang, Y.P., Zhao, Q., Liu, J.X. et al. (2017) Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Nat. Comm. 8, 14261. Liu, H., Ding, Y.D., Zhou, Y.Q., Jin, W.Q., Xie, K.B. and Chen, L.L. (2017) CRISPR-P 2.0: an improved CRISPR-Cas9 tool for genome editing in plants. Mol. Plant, 10, 530– 532. Pan, G., Zhang, X.Y., Liu, K.D., Zhang, J.W., Wu, X.Z., Zhu, J. and Tu, J.M. (2006) Map-based cloning of a novel rice cytochrome P450 gene CYP81A6 that confers resistance to two different classes of herbicides. Plant Mol. Biol. 61, 933– 943. Sun, Y.W., Li, J.Y. and Xia, L.Q. (2016) Precise genome modification via sequence-specific nucleases-mediated gene targeting for crop improvement. Front. Plant Sci. 7, 1928. Uraguchi, S., Kamiya, T., Sakamoto, T., Kasai, K., Sato, Y., Nagamura, Y., Yoshida, A. et al. (2011) Low-affinity cation transporter (OsLCT1) regulates cadmium transport into rice grains. Proc. Natl. Acad. Sci. USA, 108, 20959– 20964. Xie, K.B., Minkenberg, B. and Yang, Y.N. (2015) Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc. Natl. Acad. Sci. USA, 112, 3570– 3575. Zhu, C., Bortesi, L., Baysal, C., Twyman, R.M., Fischer, R., Capell, T., Schillberg, S. et al. (2017) Characteristics of genome editing mutations in cereal crops. Trend Plant Sci. 22, 38– 52. Citing Literature Volume15, Issue11November 2017Pages 1371-1373 FiguresReferencesRelatedInformation

Precise Gene Replacement in Rice by RNA Transcript-Templated Homologous Recombination.

An Efficient Marker Gene Excision Strategy Based on CRISPR/Cas9-Mediated Homology-Directed Repair in Rice

A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants

Induction of Targeted, Heritable Mutations in Barley and Brassica Oleracea Using RNA-guided Cas9 Nuclease

Engineering Herbicide-Resistant Rice Plants Through CRISPR/Cas9-Mediated Homologous Recombination of Acetolactate Synthase.

Targeted, Efficient Sequence Insertion and Replacement in Rice.

An alternative strategy for targeted gene replacement in plants using a dual-sgRNA/Cas9 design

Gene replacements and insertions in rice by intron targeting using CRISPR–Cas9

Crispr-S: An Active Interference Element For A Rapid And Inexpensive Selection Of Genome-Edited, Transgene-Free Rice Plants

Gene targeting using the Agrobacterium tumefaciens-mediated CRISPR-Cas system in rice

HRM-facilitated Rapid Identification and Genotyping of Mutations Induced by CRISPR/Cas9 Mutagenesis in Rice

Precise and heritable gene targeting in rice using a sequential transformation strategy.

Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System

CRISPR‐S: an Active Interference Element for a Rapid and Inexpensive Selection of Genome‐edited, Transgene‐free Rice Plants

A donor-DNA-free CRISPR/Cas-based approach to gene knock-up in rice

Generation of Targeted Mutant Rice Using a CRISPR-Cpf1 System.

Efficient protein tagging and cis-regulatory element engineering via precise and directional oligonucleotide-based targeted insertion in plants

Gene Targeting via CRISPR/Cas9-Mediated DNA Double-Strand Break Induction in Rice

An Update on Precision Genome Editing by Homology-Directed Repair in Plants

CRISPR/Cas9 and Agrobacterium tumefaciens virulence proteins synergistically increase efficiency of precise genome editing via homology directed repair in plants

Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice