Abstract:Plant Biotechnology JournalVolume 15, Issue 11 p. 1371-1373 LetterOpen Access CRISPR-S: an active interference element for a rapid and inexpensive selection of genome-edited, transgene-free rice plants Hai-Ping Lu, Hai-Ping Lu National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorSong-Mei Liu, Song-Mei Liu National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorShou-Ling Xu, Shou-Ling Xu Institute of Nuclear Agricultural Sciences, Zhejiang University, Hangzhou, ChinaSearch for more papers by this authorWu-Yang Chen, Wu-Yang Chen National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorXin Zhou, Xin Zhou National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, ChinaSearch for more papers by this authorYuan-Yuan Tan, Yuan-Yuan Tan National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorJian-Zhong Huang, Jian-Zhong Huang Institute of Nuclear Agricultural Sciences, Zhejiang University, Hangzhou, ChinaSearch for more papers by this authorQing-Yao Shu, Corresponding Author Qing-Yao Shu qyshu@zju.edu.cn National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaCorrespondence (Tel (+86)-571-86971405; fax (+86)-571-86971405; email qyshu@zju.edu.cn)Search for more papers by this author Hai-Ping Lu, Hai-Ping Lu National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorSong-Mei Liu, Song-Mei Liu National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorShou-Ling Xu, Shou-Ling Xu Institute of Nuclear Agricultural Sciences, Zhejiang University, Hangzhou, ChinaSearch for more papers by this authorWu-Yang Chen, Wu-Yang Chen National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorXin Zhou, Xin Zhou National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, ChinaSearch for more papers by this authorYuan-Yuan Tan, Yuan-Yuan Tan National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaSearch for more papers by this authorJian-Zhong Huang, Jian-Zhong Huang Institute of Nuclear Agricultural Sciences, Zhejiang University, Hangzhou, ChinaSearch for more papers by this authorQing-Yao Shu, Corresponding Author Qing-Yao Shu qyshu@zju.edu.cn National Key Laboratory of Rice Biology and Zhejiang Provincial Key Laboratory of Crop Germplasm Resources, Institute of Crop Science, Zhejiang University, Hangzhou, China Hubei Collaborative Innovation Center for the Grain Industry, Jingzhou, Hubei, ChinaCorrespondence (Tel (+86)-571-86971405; fax (+86)-571-86971405; email qyshu@zju.edu.cn)Search for more papers by this author First published: 08 July 2017 https://doi.org/10.1111/pbi.12788Citations: 60AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat Dear Editor, The CRISPR/Cas9-based genome-editing tool has been used in diverse applications related to plant research, including for crop improvement (Liu et al., 2017; Sun et al., 2016). Mutant plants may be generated via transient transformations or DNA-free editing (Liang et al., 2017). However, plant genomes are often edited during the production of transgenic plants, in a process that involves the identification of targeted edits in regenerated T0 plants and the subsequent elimination of transgenes in T1 plants (Sun et al., 2016). Because T-DNA (e.g. CRISPR/Cas9) is randomly inserted into plant genomes, it may be silent (e.g. when incorporated in heterochromatin) or is actively silenced; hence, theoretically only a portion of the T0 plants carry active transgenes, although high genome-editing rates have been observed (Xie et al., 2015). Therefore, selecting transgene-free plants with an edited genome may be a time-consuming and costly part of genome-editing projects. This is especially true for practical breeding programmes when many plants need to be produced and screened, considering that successful application is often genotype dependent (Zhu et al., 2017). The RNA interference (RNAi) technique has already been used to decrease the abundance of unwanted grain ingredients or increase resistance to viral pathogens (Kamthan et al., 2015). Functional RNAi elements (e.g. hairpin RNAi, hpRNAi) can be detected in T0 plants because of their dominant nature. Therefore, we hypothesized that when an RNAi expression element is incorporated into a CRISPR/Cas9 vector, the activity and presence of the T-DNA in the transgenic plants can be monitored based on RNAi. This would enable a PCR-free, phenotype-based identification of genome-edited T0 plants, and a subsequent selection of transgene-free T1 plants. In rice, CYP81A6 encodes a P450 cytochrome protein that confers resistance to bentazon. Silencing CYP81A6 may render rice plants susceptible to the herbicide (Pan et al., 2006). We speculated that a CYP81A6-hpRNAi may be a suitable marker for CRISPR/Cas9 expression. To produce a CYP81A6-hpRNAi element, we first amplified a 300-bp fragment from CYP81A6 using forward (5′AGCTTAGCCATGGATAACGCCTAC3′) and reverse (5′AAGGTCACGTCGTGCTCGGTGAAGCACTC3′) primers. The fragment was then inserted into the pBSSK-IN vector to form a hairpin structure, which was then introduced into a pCAMBIA-1300 vector between the double 35S (d35S) promoter and the Nos terminator (nos). We inserted the d35S-hpRNAi-nos element into the HpaI site near the left border of a CRISPR/Cas9 vector, pHun4c12, to construct a new CRISPR/Cas9 vector, pHun4c12s (Figure 1a). To test the utility of pHun4c12s, we constructed another CRISPR/Cas9 expression vector, pHun4c12s-lct1, to target OsLCT1, which encodes a Cd transporter (Uraguchi et al., 2011). Ninety-six independent transgenic T0 plants were generated via Agrobacterium tumefaciens-mediated transformation of japonica rice genotype Xidao #1 cells with pHun4c12s-lct1 and analysed further. Figure 1Open in figure viewerPowerPoint Production of genome-edited, transgene-free rice plants. (a) Diagram of a CRISPR-S vector, pHun4c12s, derived from pHun4c12. (b) Bentazon-resistant (left, T0-R) and bentazon-susceptible (right, T0-S) tillers of transgenic T0 plants. (c) and (d) Box plot representations of Cas9 (c) and CYP81A6 (d) relative transcript levels of T0-S and T0-R plants. The values of one arbitrarily chosen T0-R plant (c) and one T0-S plant (d) were set as 1. For each box plot, the 10th, 25th, median, 75th and 90th percentiles of relative transcript levels were represented by horizontal lines (bottom to top), the average as filled circles, and the minimum and maximum indicated by empty triangles. (e) Illustration of the genetics of genome editing, bentazon susceptibility, and segregation of transgene and genome edits. In transgene-expressing T0 plants, the target gene (empty circle) is edited by the CAS9 and sgRNA complex to introduce mutations (filled circle). Meanwhile, CYP81A6-hpRNAi degrades CYP81A6 transcripts, rendering plants susceptible to bentazon. In contrast, the genomes of T0 plants with a silenced transgene are not edited, and these plants remain resistant to bentazon. Transgene-free (i.e. resistant to bentazon), genome-edited T1-R plants are produced by bentazon treatment, which kills transgenic T1-S plants. (f) Symptoms of Line #2 T1 seedlings 1 week after a bentazon foliar spray (1000 mg/L). (g) Segregation of bentazon-susceptible (filled) and bentazon-resistant (empty) plants in 16 T1 lines. Lines fit the 3:1 or 16:1 ratios based on a chi-square test are indicated with triangles or squares, respectively. Line #19 T1 plants are indicated with a filled star. (h) T-DNA copy number in Line #19 plants assessed by a qRT-PCR analysis of Cas9, with Actin as the internal standard, and the value of Line #2 T0 plant set as 1. Actin was used as the internal standard in qRT-PCR analysis. First, we tested the susceptibility of the T0 plants to bentazon using a foliar spray. Tillers of T0 plants were separated and grown as two subplants. One normally growing subplant of each T0 plant was treated with a bentazon solution (2000 mg/L) by spraying until droplets were visible on leaves. About 1 week later, 29 T0 subplants appeared to be susceptible and eventually died (T0-S plants; Figure 1b). The other 67 T0 plants were not visibly affected (T0-R plants). Second, we sequenced the OsLCT1 target region of the T0 plants. All 29 T0-S plants were affected by homozygous (aa), biallelic (aa′) or heterozygous (Aa) mutations in the target region. Mutations were not detected in the remaining plants. Thus, bentazon susceptibility was 100% correlated with the targeted mutations in T0 plants. Third, we analysed the abundance of Cas9 and CYP81A6 transcripts in T0-R and T0-S plants using a quantitative real-time PCR (qRT-PCR). Overall, the Cas9 transcript was significantly more abundant in T0-S plants than in T0-R plants (Figure 1c). In contrast, the abundance of the CYP81A6 transcript was lowest in the T0-S plants (Figure 1d), suggesting that CYP81A6-hpRNAi was more highly expressed in these plants. The expression of CYP81A6-hpRNAi resulted in the degradation of CYP81A6 transcripts via RNAi in transgene-expressing, T0-S plants. In contrast, the transgene-silenced T0 plants remained resistant to bentazon (Figure 1e). These observations imply that CYP81A6-hpRNAi enables the efficient selection of genome-edited T0 plants. Our system was also designed to simplify the selection of transgene-free T1 plants. We grew 72 seedlings for each of 16 T1 lines derived from homozygous or biallelic OsLCT1 mutant T0 plants treated them with 1000 mg/L bentazon in a foliar spray (approximately 100 mL/m2) at around the four-leaf stage. About 4 days later, we observed that all Xidao #1 seedlings were growing normally, but some of the T1 seedlings started dehydrating and eventually died (Figure 1f). Furthermore, we proved that all bentazon-susceptible plants were transgenic, while all bentazon-resistant plants lacked T-DNA. The segregation of T1 plants derived from a homozygous or biallelic genome-edited T0 plant is presented in Figure 1e, in which the genome-edited, transgene-free plants are resistant to bentazon because the CYP81A6-hpRNAi no longer exists. Meanwhile, transgenic plants are susceptible because the CYP81A6 transcripts are degraded. Transgenic plants produced by A. tumefaciens-mediated transformation often carry one or two copies of T-DNA (Collier et al., 2017). The segregation ratio observed for bentazon susceptibility was consistent with this fact in all T1 lines except for Line #19 (Figure 1g). All Line #19 T1 seedlings were susceptible to bentazon and died. Based on the 3:1 segregation ratio of its T1 population (Figure 1g), the Line #2 T0 plant was expected to have a single T-DNA insertion and was therefore used as the control for the qRT-PCR analysis. The Line #19 T0 plant and its T1 progenies appeared to have the same T-DNA copy number, and they all had double the number of insertions of the Line #2 T0 plant (Figure 1h). This implies that T-DNA copies were incorporated into sister chromosomes in Line #19 T0 plant. Otherwise, variability in the T-DNA copy numbers among the T1 plants would have been detected. To test the utility of CRISPR-S for other genes, we constructed a pHun4c12s-frg vector to target OsBADH2 (Bradbury et al., 2005). We transformed nine rice genotypes and obtained 4–22 T0 plants for each genotype. All T0 plants susceptible to bentazon were confirmed to carry mutations. Similarly, transgene-free, OsBADH2-edited T1 plants were identified following a bentazon treatment of T1 seedlings. The results of our proof-of-concept study revealed that the Cas9 expression level could be indirectly estimated using a marker trait generated by an RNAi element incorporated into the CRISPR/Cas9 expression vector. This new CRISPR/Cas9 system provides a relatively simple way of identifying and eliminating T0 plants in which the genome has not been edited. More importantly, our method enables the selection of transgene-free T1 plants, with almost no cost, confirming the value of this system. Antibiotic or herbicide resistance genes in binary vectors are important for selecting transgenic plants. However, they cannot be directly used to select transgene-free T1 plants because they would kill the plants. Seed-localized fluorescent reporters have been used to discriminate between transgenic and nontransgenic seeds in a few plant species. Unfortunately, they are unsuitable for species that produce seeds with hulls or glumes such as rice. Although our system has been demonstrated in rice, it may be possible to develop similar systems in other plant species. Highly conserved homologs of CYP81A6 have been detected in monocots. Thus, the bentazon-susceptibility trait may also be used in these plant species. Furthermore, other suitable marker traits can be generated by down-regulating the expression of other genes to introduce visible morphological changes to leaf shape and colour, among other characteristics. Funding This work was supported by the Zhejiang Provincial S & T Project on Breeding of Agricultural (Food) Crops (grant no. 2016C02050-2). Author Contributions Q.-Y. S., H.-P. L. and J.-Z. H designed the experiments, analysed the data and wrote the manuscript; H.-P. L. conducted the experiments with the assistance of S.-M. L., S.-L. X., W.-Y. C., X. Z. and Y.-Y. T. Acknowledgments We thank Dr. Pengcheng Wei for providing the original CRISPR/Cas9 vector (pHun4c12). The authors have no conflicts of interest to declare. References Bradbury, L., Fitzgerald, T., Henry, R., Jin, Q. and Waters, D. (2005) The gene for fragrance in rice. Plant Biot. J. 3, 363– 370. Collier, R., Dasgupta, K., Xing, Y.P., Hernandez, B.T., Shao, M., Rohozinski, D., Kovak, E. et al. (2017) Accurate measurement of transgene copy number in crop plants using droplet digital PCR. Plant J. 90, 1014– 1025 https://doi.org/10.1111/tpj.13517. Kamthan, A., Chaudhuri, A., Kamthan, M. and Datta, A. (2015) Small RNAs in plants: recent development and application for crop improvement. Front. Plant Sci. 6, 208. Liang, Z., Chen, K.L., Li, T.D., Zhang, Y., Wang, Y.P., Zhao, Q., Liu, J.X. et al. (2017) Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Nat. Comm. 8, 14261. Liu, H., Ding, Y.D., Zhou, Y.Q., Jin, W.Q., Xie, K.B. and Chen, L.L. (2017) CRISPR-P 2.0: an improved CRISPR-Cas9 tool for genome editing in plants. Mol. Plant, 10, 530– 532. Pan, G., Zhang, X.Y., Liu, K.D., Zhang, J.W., Wu, X.Z., Zhu, J. and Tu, J.M. (2006) Map-based cloning of a novel rice cytochrome P450 gene CYP81A6 that confers resistance to two different classes of herbicides. Plant Mol. Biol. 61, 933– 943. Sun, Y.W., Li, J.Y. and Xia, L.Q. (2016) Precise genome modification via sequence-specific nucleases-mediated gene targeting for crop improvement. Front. Plant Sci. 7, 1928. Uraguchi, S., Kamiya, T., Sakamoto, T., Kasai, K., Sato, Y., Nagamura, Y., Yoshida, A. et al. (2011) Low-affinity cation transporter (OsLCT1) regulates cadmium transport into rice grains. Proc. Natl. Acad. Sci. USA, 108, 20959– 20964. Xie, K.B., Minkenberg, B. and Yang, Y.N. (2015) Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc. Natl. Acad. Sci. USA, 112, 3570– 3575. Zhu, C., Bortesi, L., Baysal, C., Twyman, R.M., Fischer, R., Capell, T., Schillberg, S. et al. (2017) Characteristics of genome editing mutations in cereal crops. Trend Plant Sci. 22, 38– 52. Citing Literature Volume15, Issue11November 2017Pages 1371-1373 FiguresReferencesRelatedInformation

Abstract:Single-nucleotide polymorphism (SNP) is an abundant form of genetic variation among individuals in plant species, which has been believed to have effects on the gene function responsible for phenotypic diversity. Utilization of functional SNPs associated with diverse important agronomic traits is of great value in crop improvements. Recently, a simple base editing system, which introduces a single-nucleotide change in genes of interest for generating gain-of-function mutants, has been developed in plants (Li et al., 2017Li J. Sun Y. Du J. Zhao Y. Xia L. Generation of targeted point mutations in rice by a modified CRISPR/Cas9 system.Mol. Plant. 2017; 10: 526-529Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, Lu and Zhu, 2017Lu Y. Zhu J.K. Precise editing of a target base in the rice genome using a modified CRISPR/Cas9 system.Mol. Plant. 2017; 10: 523-525Abstract Full Text Full Text PDF PubMed Scopus (274) Google Scholar, Ren et al., 2017Ren B. Yan F. Kuang Y. Li N. Zhang D. Lin H. Zhou H. A CRISPR/Cas9 toolkit for efficient targeted base editing to induce genetic variations in rice.Sci. China Life Sci. 2017; 33: 516-519Crossref Scopus (68) Google Scholar), in which Cas9(D10A) nickase is engineered with the rat cytosine deaminase (APOBEC1) and the uracil glycosylase inhibitor (UGI). Under the guidance of sgRNA, the Cas9n fusion protein is directed to the target locus in the genome, deaminating cytidines (C) in the editing window (13–19 bp before the PAM sequence) into uridines (U) and enabling the introduction of thymines (T), adenines (A) or guanines (G) during DNA replication (Li et al., 2017Li J. Sun Y. Du J. Zhao Y. Xia L. Generation of targeted point mutations in rice by a modified CRISPR/Cas9 system.Mol. Plant. 2017; 10: 526-529Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, Lu and Zhu, 2017Lu Y. Zhu J.K. Precise editing of a target base in the rice genome using a modified CRISPR/Cas9 system.Mol. Plant. 2017; 10: 523-525Abstract Full Text Full Text PDF PubMed Scopus (274) Google Scholar, Ren et al., 2017Ren B. Yan F. Kuang Y. Li N. Zhang D. Lin H. Zhou H. A CRISPR/Cas9 toolkit for efficient targeted base editing to induce genetic variations in rice.Sci. China Life Sci. 2017; 33: 516-519Crossref Scopus (68) Google Scholar). However, consistent with the observation that the AID/APOBEC family members have differential sensitivities to the 5′ nucleotide preceding the target C (Beale et al., 2004Beale R.C.L. Petersen-Mahrt S.K. Watt I.N. Harris R.S. Rada C. Neuberger M.S. Comparison of the differential context-dependence of DNA deamination by APOBEC enzymes: correlation with mutation spectra in vivo.J. Mol. Biol. 2004; 337: 585-596Crossref PubMed Scopus (281) Google Scholar, Komor et al., 2016Komor A.C. Kim Y.B. Packer M.S. Zuris J.A. Liu D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.Nature. 2016; 533: 420-424Crossref PubMed Scopus (2430) Google Scholar, Komor et al., 2017Komor A.C. Zhao K.T. Packer M.S. Gaudelli N.M. Waterbury A.L. Koblan L.W. Kim Y.B. Badran A.H. Liu D.R. Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity.Sci. Adv. 2017; 3: eaao4774Crossref PubMed Scopus (399) Google Scholar), APOBEC1 shows a striking preference for TC, and the editing efficiency of GC, in general, is quite low. To broaden the application of base editing technology in rice, which is characterized by high GC content, here we further optimize our rBE system with human AID (hAID), another type of cytosine deaminase with a priority on GC and AC (Beale et al., 2004Beale R.C.L. Petersen-Mahrt S.K. Watt I.N. Harris R.S. Rada C. Neuberger M.S. Comparison of the differential context-dependence of DNA deamination by APOBEC enzymes: correlation with mutation spectra in vivo.J. Mol. Biol. 2004; 337: 585-596Crossref PubMed Scopus (281) Google Scholar), to introduce desired point mutations in the target region for gene correction or modification as a proof of concept. The full-length hAID and Petromyzon marinus CDA1 (PmCDA1) were identified with nearly no cytidine deaminase activity detected in vitro (Komor et al., 2016Komor A.C. Kim Y.B. Packer M.S. Zuris J.A. Liu D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.Nature. 2016; 533: 420-424Crossref PubMed Scopus (2430) Google Scholar), and with less efficiency of base editing in rice (Shimatani et al., 2017Shimatani Z. Kashojiya S. Takayama M. Terada R. Arazoe T. Ishii H. Teramura H. Yamamoto T. Komatsu H. Miura K. et al.Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion.Nat. Biotechnol. 2017; 35: 441-443Crossref PubMed Scopus (432) Google Scholar). In this case, the K10E/T82I/E156G hAID variant lacking the nuclear export signal sequence (termed hAID*Δ) was chosen for its improved catalytic activity (Wang et al., 2009Wang M. Yang Z.Z. Rada C. Neuberger M.S. AID upmutants isolated using a high-throughput screen highlight the immunity/cancer balance limiting DNA deaminase activity.Nat. Struct. Mol. Biol. 2009; 16: 769-776Crossref PubMed Scopus (62) Google Scholar, Hess et al., 2016Hess G.T. Fresard L. Han K. Lee C.H. Li A. Cimprich K.A. Montgomery S.B. Bassik M.C. Directed evolution using dCas9-targeted somatic hypermutation in mammalian cells.Nat. Methods. 2016; 13: 1036-1042Crossref PubMed Scopus (292) Google Scholar). The gene fragment of hAID*Δ was codon optimized for expression in rice (Supplemental Figure 1) and attached to the 5′ terminal end of Cas9n-NLS using XTEN linker (Figure 1A and 1B ). Therefore, it is likely that the editing window of hAID*Δ would be restricted to the sgRNA-targeting site similar to the case of APOBEC1. UGI was excluded at this time since more types of nucleotide conversions, produced in uracil N-glycosylase (UDG)-initiated base excision repair (BER), were anticipated. The hAID*Δ-XTEN-Cas9n-NLS chimeric gene (termed rBE5) was first tested in rice leaf sheath protoplast, with the sgRNAs targeting a GCAC-containing ApaLI restriction site in OsRLCK185 and a TCC-containing BamHI restriction site in OsCERK1. Sequencing data showed that distinct mutations with high frequency of C > T conversions occurred in the editing window (Supplemental Figure 2A–2H), suggesting rBE5 functions on GC, AC, TC as well as CC in rice cells. As a follow-up to our previous study on the development of the rBE3 system (Ren et al., 2017Ren B. Yan F. Kuang Y. Li N. Zhang D. Lin H. Zhou H. A CRISPR/Cas9 toolkit for efficient targeted base editing to induce genetic variations in rice.Sci. China Life Sci. 2017; 33: 516-519Crossref Scopus (68) Google Scholar), in this study the rBE3 gene in the binary vector pUbi:rBE3 was replaced by the rBE5 gene, namely pUbi:rBE5, and then further tested for efficiency in stable transgenic rice plants through Agrobacterium-mediated transformation. Pi-d2, an agriculturally important rice blast R gene in which a GC-containing region was resistant to rBE3-mediated editing in our earlier experiment, was first chosen for targeting (Figure 1C). As reported previously, a single amino acid substitution at position 441 in the recessive allele of Pi-d2 gene results in loss of resistance to Magnaporthe oryzae (Chen et al., 2006Chen X. Shang J. Chen D. Lei C. Zou Y. Zhai W. Liu G. Xu J. Ling Z. Cao G. et al.A B-lectin receptor kinase gene conferring rice blast resistance.Plant J. 2006; 46: 794-804Crossref PubMed Scopus (397) Google Scholar). Therefore, we assumed that introducing a G > A mutation (M441I) in endogenous pi-d2kit using rBE5 could recover its biological function. The same protospacer for rBE3 was used in this experiment; 26 independent transgenic lines of Kitaake were obtained after transformation and genotyped subsequently by Sanger sequencing. Eight heterozygous lines (30.8% efficiency) carrying a desired single G to A conversion at position −17 upstream of PAM were identified (Figure 1D and 1E; Supplemental Figure 3A), suggesting that rBE5 is much more efficient on target C that immediately follow a G than rBE3. We assumed that the successful gene correction of pi-d2 would be attributable to both the specificity and the improved activity of hAID*Δ. Remarkably, pi-d2 alleles with Indel mutations were also detected in five lines (Supplemental Figure 3B and 3C). In light of robust biochemical activity of hAID*Δ, we speculated that rBE5 might induce various point mutations of C2843 in OsFLS2, the rice homolog of the Arabidopsis flagellin-sensing receptor kinase gene FLS2, possibly leading to replacement of phosphorylation-blocking residue Ala948 by phosphorylation-mimic residues Asp or Glu (Figure 1F), and rendering rice plants more defensive to bacterial pathogens. As shown in Figure 1G–1I and Supplemental Figure 4A and 4B, of 114 independent transgenic lines confirmed by Sanger sequencing, 65 homozygous or heterozygous lines (57.0% efficiency) were identified with nucleotide changes in the OsFLS2 kinase domain; most of genomic variations were located in the editing window (position −18 to −14) upstream of PAM. rBE5 converted C to the other three bases, but more notably to T. In addition, a low level of G > C conversion in the editing window and C > A conversion near the target region were also found in our analysis. Notably, cytidine conversions occurred in the sequence context characterized by GC as well as CC. Finally, one heterozygous line in which the OsFLS2 allele carried C2834A, C2843A, and C2847T conversions (Figure 1G), encoding phosphorylation-mimic residues A945E, A948D, and unchanged G949, respectively, was identified as expected. To our surprise, 82 lines (71.9% frequency) were identified with mono- or bi-allelic Indel mutations, suggesting rBE5 is more active in inducing Indel mutations in rice than rBE3 and rBE4. This would not be problematic because Indels and nucleotide conversions resided on separate chromosomes in most cases (Figure 1I and Supplemental Figure 5), and will segregate during gametes production. Further sequence data analysis of 196 OsFLS2 alleles with genetic variations showed that the majority of Indel mutations occurred in the editing window, likely resulting from the unfaithful BER of the uracil through nonhomologous end joining (NHEJ). Therefore, cytidine deamination activity of rBE5 might be responsible for the genomic variations that occurred in 78.6% of OsFLS2 alleles. UGI from Bacillus subtilis bacteriophage PBS1 is capable of blocking UDG activity. It potentially subverts BER at the site of base editing (Komor et al., 2016Komor A.C. Kim Y.B. Packer M.S. Zuris J.A. Liu D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.Nature. 2016; 533: 420-424Crossref PubMed Scopus (2430) Google Scholar). Thereby, we fused UGI gene to the 3′ terminal of rBE5, resulting in rBE9, in order to further improve the base editing efficiency and outcome fidelity. As shown in Figure 1K, unwanted Indel mutations were drastically inhibited in the presence of UGI. However, Indel occurrence was positively correlated with the base editing efficiency, presumably due to the great performance of hAID*Δ at certain loci. rBE3 was also tested side by side with rBE9 to evaluate its effects on base editing in different sequence contexts at four different chromosomal sites (OsAOS1, OsJAR1, OsJAR2, and OsCOI2) in rice transgenic calli. Detailed sequence analysis (Figure 1K and 1L; Supplemental Figures 6–9) indicated that the base editing efficiencies of rBE9 were comparable with or more enhanced than that of rBE3. Notably, rBE9 functioned more robustly on GC and more efficiently on multiple target C in the editing window of sgRNA than rBE3, resulting in more genetic variation at the target loci. Next, we genotyped the T1 progeny plants to investigate whether the nucleotide changes introduced by rBE5 could be transmitted to the next generation of the selfed T0 plants. Direct sequencing analysis of pi-d2 or OsFLS2 in 170 individual T1 progeny plants showed that homozygous plants with either edited nucleotides or Indels were all identified (Supplemental Figure 10). Furthermore, transgene-free plants harboring stable DNA changes were also isolated through detecting the presence of T-DNA (Cas9, hptII and sgRNA genes) by PCR amplification (Supplemental Figure 10). We recently reported a CRISPR/Cas9 toolkit containing pUbi:rBE3 and pUbi:rBE4 for efficient targeted base editing to induce genetic variations in rice (Ren et al., 2017Ren B. Yan F. Kuang Y. Li N. Zhang D. Lin H. Zhou H. A CRISPR/Cas9 toolkit for efficient targeted base editing to induce genetic variations in rice.Sci. China Life Sci. 2017; 33: 516-519Crossref Scopus (68) Google Scholar). In this study, we have further expanded the toolkit with pUbi:rBE5 and pUbi:rBE9, which harbor an engineered hyperactive hAID mutant version. Distinct from the rat APOBEC1-containing rBE3 and rBE4, which exhibit high deaminase activity on TC, the hAID*Δ-based rBE5 and rBE9 proteins favor GC, and function on AC, TC, and CC as well. Therefore, the pUbi:rBE5 and pUbi:rBE9 vector would be much more useful for targeted point mutation in rice in terms of the high GC content of the rice genome. In addition, compared with the undetected in vitro deaminase activity of full-length hAID (Komor et al., 2016Komor A.C. Kim Y.B. Packer M.S. Zuris J.A. Liu D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.Nature. 2016; 533: 420-424Crossref PubMed Scopus (2430) Google Scholar) and poor performance of full-length PmCDA1 in rice (Shimatani et al., 2017Shimatani Z. Kashojiya S. Takayama M. Terada R. Arazoe T. Ishii H. Teramura H. Yamamoto T. Komatsu H. Miura K. et al.Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion.Nat. Biotechnol. 2017; 35: 441-443Crossref PubMed Scopus (432) Google Scholar), AID*Δ shows highly enhanced base editing efficiency in generating both gain-of-function and loss-of-function mutants of rice. Therefore, we assume AID*Δ could be suitable for targeted base editing in other monocots and dicots as well. Overall, this base editor toolkit is powerful and has potential to be widely applied in both biological studies and crop molecular breeding in the future. B.R., F.Y., Y.K., D.Z., X.Z., H.L., and H.Z. designed the experiments; B.R., F.Y., Y.K., N.L., X.Z., and H.Z. performed experiments; B.R., F.Y., D.Z., X.Z., H.L., and H.Z. wrote the paper. We thank Dr. Li Yuan for proofreading. This study was supported by grants from the National Key R&D Program of China (2017YFD0200900), the Agricultural Science and Technology Innovation Program of The Chinese Academy of Agricultural Sciences to H.Z., and a grant from the National Natural Science Foundation of China (31701780) to F.Y. The authors have filed a patent application based on the results reported in this study. Download .pdf (2.48 MB) Help with pdf files Document S1. Supplemental Methods, Supplemental Figures 1–10, and Supplemental Tables 1 and 2

CRISPR‐S: an Active Interference Element for a Rapid and Inexpensive Selection of Genome‐edited, Transgene‐free Rice Plants

An Efficient Marker Gene Excision Strategy Based on CRISPR/Cas9-Mediated Homology-Directed Repair in Rice

A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants

Construction of a genomewide RNAi mutant library in rice.

Crispr-S: An Active Interference Element For A Rapid And Inexpensive Selection Of Genome-Edited, Transgene-Free Rice Plants

Shortened Snrna Promoters for Efficient CRISPR/Cas-based Multiplex Genome Editing in Monocot Plants

Induction of Targeted, Heritable Mutations in Barley and Brassica Oleracea Using RNA-guided Cas9 Nuclease

Improved Base Editor for Efficiently Inducing Genetic Variations in Rice with CRISPR/Cas9-Guided Hyperactive hAID Mutant

HRM-facilitated Rapid Identification and Genotyping of Mutations Induced by CRISPR/Cas9 Mutagenesis in Rice

Construction and Genetic Transformation of RNA Interference Vectors for OsCPK9 Gene in Rice

Multiplexed CRISPR-Cas9 mutagenesis of rice PSBS1 noncoding sequences for transgene-free overexpression

Gene targeting using the Agrobacterium tumefaciens-mediated CRISPR-Cas system in rice

Genome editing in plants using the TnpB transposase system

Efficient plant genome engineering using a probiotic sourced CRISPR-Cas9 system

Expanding plant genome editing scope and profiles with CRISPR‐FrCas9 systems targeting palindromic TA sites

Genome editing in rice and tomato with a small Un1Cas12f1 nuclease

CRISPR/Cpf1-mediated DNA-free plant genome editing

PAM-less plant genome editing using a CRISPR–SpRY toolbox

Efficiency, Specificity and Temperature Sensitivity of Cas9 and Cas12a RNPs for DNA-free Genome Editing in Plants

A Large-Scale Whole-Genome Sequencing Analysis Reveals Highly Specific Genome Editing by Both Cas9 and Cpf1 (cas12a) Nucleases in Rice

A donor-DNA-free CRISPR/Cas-based approach to gene knock-up in rice