Abstract:The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing. A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24). Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/μl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/μl) and healthy controls (mean: 247±72 copies/μl), neither among only HIV subjects, when stratified based on viral load or CD4 count. No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).

Plasma Mitochondrial DNA Levels As a Biomarker of Lipodystrophy among HIV-infected Patients Treated with Highly Active Antiretroviral Therapy (HAART).

Increased Microbial Translocation is a Prognostic Biomarker of Different Immune Responses to ART in People Living with HIV

The Impact of Highly Active Antiretroviral Treatment on the Blood Profiles of Patients with Acquired Immune Deficiency Syndrome

Microrna-155 is A Biomarker of T-Cell Activation and Immune Dysfunction in Hiv-1-Infected Patients

Muscle and liver lactate metabolism in HAART-treated and naive HIV-infected patients: the MITOVIR study

Plasma metabolic changes in Chinese HIV-infected patients receiving lopinavir/ritonavir based treatment: Implications for HIV precision therapy

Study on Plasma Metabolomics for HIV/AIDS Patients Treated by HAART Based on LC/MS-MS

Donor Plasma Mitochondrial DNA is Correlated with Posttransplant Renal Allograft Function

Evaluation of lipid metabolism imbalance in HIV-infected patients with metabolic disorders using high-performance liquid chromatography-tandem mass spectrometry

A Plasma Biomarker Signature of Immune Activation in HIV Patients on Antiretroviral Therapy.

Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

Plasma proteomic signatures of liver steatosis and fibrosis in people living with HIV: a cross-sectional study

Hypoadiponectinemia in lipodystrophic HIV individuals: a metabolic marker of subclinical cardiac damage

Temporal Changes in Plasma Metabolic Signatures to Predict Immune Response of Antiretroviral Therapy among People Living with HIV.

Untargeted Plasma Metabolomics Reveals Extensive Metabolic Alterations among Treatment-Naive Human Immunodeficiency Virus/Hepatitis C Virus Co-Infected Patients with Liver Disease Progression

Plasma Lipidomic Profiles in cART-Treated Adolescents with Perinatally Acquired HIV Compared to Matched Controls

A novel U-shaped relationship between mitochondrial mass and risk of incomplete immune reconstitution in HIV-infected patients on antiviral therapy

Gene expression and immunohistochemistry in adipose tissue of HIV type 1-infected patients with nucleoside analogue reverse-transcriptase inhibitor-associated lipoatrophy

Plasma MicroRNA Signature Panel Predicts the Immune Response After Antiretroviral Therapy in HIV-Infected Patients

Plasma metabolomic profile is near-normal in people with HIV on long-term suppressive antiretroviral therapy

Lipids, biomarkers, and subclinical atherosclerosis in treatment-naive HIV patients starting or not starting antiretroviral therapy: Comparison with a healthy control group in a 2-year prospective study