Abstract:Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Association of Tissue Inhibitor of Metalloproteinase Gene Polymorphisms and Unexplained Recurrent Spontaneous Abortions in Han Chinese Couples.

The relationship between polymorphisms in the promoter region of Tim-3 and unexplained recurrent spontaneous abortion in Han Chinese women

[Relationship between IL-18 gene polymorphism and unexplained recurrent spontaneous abortion].

Relationship Between IL-10 Promoter Gene Polymorphisms and the Susceptibility to Endometriosis

[The Association Between the Polymorphisms of Mirna Biogenesis Related Genes(DICER,DROSHA and RAN)and Unexplained Recurrent Spontaneous Abortion in Chinese Women].

The Association between Polymorphisms of 5,10-Methylenetetrahydrofolate Reductase Gene C677T and the Unexplained Recurrent Spontaneous Abortion:A Meta-analysis

Association Between Kiaa0319l, Pxk and Jazf1 Gene Polymorphisms and Unexplained Recurrent Pregnancy Loss in Chinese Han Couples

The association of ss77136219 A > G polymorphism in the promoter of TLR4 gene with the risk of unexplained recurrent miscarriages

Expression of Tim-3 in peripheral blood mononuclear cells and placental tissue in unexplained recurrent spontaneous abortion.

A/G Polymorphism at Position 49 in Exon 1 of CTLA-4 Gene in Chinese Women with Unexplained Recurrent Spontaneous Abortion

Polymorphisms in Tissue Inhibitors of Metalloproteinases-2 and -3 and Breast Cancer Susceptibility and Survival.

Association of polymorphisms of HLA-DRB1 gene with unexplained recurrent spontaneous abortion in ethnic Hans from Henan

Association of polymorphisms of the MMP-2 and TIMP-2 genes with the risk of endometriosis in North Chinese women.

Abnormal expression of Tim -3 in unexplained recurrent spontaneous abortion

Polymorphisms in myeloperoxidase and tissue inhibitor of metalloproteinase-1 genes and their association with preeclampsia in the Chinese Han population

Soluble costimulatory molecule sTim3 regulates the differentiation of Th1 and Th2 in patients with unexplained recurrent spontaneous abortion

Polymorphisms of the TIM-1 Gene Are Associated with Rheumatoid Arthritis in the Chinese Hui Minority Ethnic Population.

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing

Study on the Correlation Between HLA-DRB1 Genes and Unexplained Recurrent Spontaneous Abortions in Xiangxi Tujia and Han Population

The association of polymorphisms in promoter region of MMP2 and MMP9 with recurrent spontaneous abortion risk in Chinese population.

No Association Between Tnf-Alpha-308g/A Polymorphism And Idiopathic Recurrent Miscarriage: A Systematic Review With Meta-Analysis And Trial Sequential Analysis