Abstract:Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

A/G Polymorphism at Position 49 in Exon 1 of CTLA-4 Gene in Chinese Women with Unexplained Recurrent Spontaneous Abortion

[Relationship between IL-18 gene polymorphism and unexplained recurrent spontaneous abortion].

Expression of TLR2 and TLR4 on Decidual and Villi in Unexplained Recurrent Spontaneous Abortion and Its Significance.

Relationship Between IL-10 Promoter Gene Polymorphisms and the Susceptibility to Endometriosis

Frequency of HLA‑G UTR‑1/UTR‑3/UTR‑7 in women with unexplained recurrent spontaneous abortion

[Association of XPC gene polymorphisms with breast cancer risk].

[Analysis of the Mutations of BRCA1 in 9 Familiar Breast Cancer Patients].

Associations between androgen receptor CAG & GGN repeat polymorphism & recurrent spontaneous abortions in Chinese women.

Association among Cytotoxic T-lymphocyte Antigen 4 Gene, Rs231775 Polymorphism, and Recurrent Pregnancy Loss Risk.

Study on the association between OX40L gene polymorphism and recurrent spontaneous abortion

The relationship between polymorphisms in the promoter region of Tim-3 and unexplained recurrent spontaneous abortion in Han Chinese women

Relationship between gene polymorphism of TNFR1 and UESA

Relationship Between Cytokine Gene Polymorphisms and Recurrent Spontaneous Abortion.

Association of HLA-DQB1 Coding Region with Unexplained Recurrent Spontaneous Abortion.

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing

Expression of CD28 and Cytotoxic T Lymphocyte Antigen 4 at the Maternal-Fetal Interface in Women with Unexplained Pregnancy Loss.

Killer Immunoglobulin-Like Receptor Repertoire on Uterine Natural Killer Cell Subsets in Women with Recurrent Spontaneous Abortions.

A Variant in Interleukin-2 Gene is Associated with Repeated Spontaneous Abortion in Ningxia Han People

Proportional Change of Cd4(+)Cd25(+) Regulatory T Cells in Decidua and Peripheral Blood in Unexplained Recurrent Spontaneous Abortion Patients

Identification of a Novel P1PK Allele (a4galt*c.1‐504_1044del1548) in Two Chinese Sisters with a History of Recurrent Spontaneous Abortion

Inherited Thrombophilia Factors in Patients with Unexplained Recurrent Spontaneous Abortion