First Detection of the Splice Donor Site IVS-I-2 (T-->B) Beta-Thalassemia Mutation in a Chinese Patient.

Can Liao,Jian Li,Yining Huang,Dongzhi Li

2005-01-01

Abstract:We present the first description of a Chinese family with a rare b-thalassemia mutation commonly observed in black Americans. This mutation is a splice donor site mutation, and is associated with a phenotype of beta0-thalassemia.

What problem does this paper attempt to address?

Prevention of Hb Bart’s (γ4) Disease Associated with the – –Thaiα0-Thalassemia Deletion in Mainland China

Dong-Zhi Li,Yan Li,Jian Li,Shu-Chen Li,Ru Li

DOI: https://doi.org/10.3109/03630269.2015.1067820

2015-01-01

Hemoglobin

Abstract:alpha-Thalassemia (alpha-thal) is a common inherited disease in southern China. The severest form is Hb Bart's (gamma(4)) disease, in which the affected fetuses almost always die in utero or shortly after birth, and the mothers are at high risk for severe morbidity. The most common type of alpha(0)-thalassemia (alpha(0)-thal) in southern China is Southeast Asian (- -(SEA)) deletion. Occasionally, Hb Bart's disease, caused by a compound heterozygosity for the - -(SEA) and - -(THAI) alpha(0)-thal deletions, can also be encountered. In this study, we report our experience with the prevention of Hb Bart's disease associated with the - -(THAI) alpha(0)-thal deletion. A total of 385 couples at risk for Hb Bart's disease, including seven who tested positive for the - -(SEA) deletion in one partner and the - -(THAI) deletion in the other, were found. Different prenatal procedures were offered, depending on the gestational age at presentation. Sixty-six affected fetuses were diagnosed prenatally; among these, two cases of Hb Bart's disease were compound heterozygotes for the - -(SEA) and - -(THAI) deletions. All affected pregnancies were terminated in time. We also presented a diagnostic protocol for identification of alpha(0)-thal trait that can reduce the number of samples for detection of the - -(THAI) deletion.
A Rare Beta-Thalassaemia Mutation (C-T) at Position -90 of the Beta-Globin Gene Discovered in a Chinese Family.

Shiqi Jia,Xiongwu Lao,Wenjun Li,Jianying Ma,Qiuhua Mo,Xiangmin Xu

2003-01-01

Haematologica

Abstract:We provide the first description of a Chinese family with three heterozygotes for a rare beta-thalassemia mutation previously observed in a Portuguese carrier. The mutation (-90 C-T) changes the conserved promoter sequence within the proximal CACCC box of the beta-globin gene; this can reduce beta-globin transcription significantly.
Identification of a Novel Β-Thalassemia Mutation at Codon 130 (+T) (HBB: C.391inst) in Han Chinese.

Wen-Juan Wang,Zi-Xuan Ding,Hui-Min Zhang,Ting-Ting Tao,Su-Ning Chen,Ling Xi

DOI: https://doi.org/10.1080/03630269.2020.1862183

2021-01-01

Hemoglobin

Abstract:β-Thalassemia (β-thal) is an inherited blood disorder characterized by reduced or absent synthesis of the β chains of hemoglobin (Hb). Although more than 900 β-globin gene mutations around the world have been identified, here we report a novel mutation detected in a Chinese subject of Han ethnicity. This allele develops by insertion of one nucleotide (+T) at codon 130 (HBB: c.391insT) in the third exon of the β-globin gene. The mutation causes a frameshift that leads to a termination codon at codon 139. The identification of the novel mutation will facilitate future diagnosis of β-thal and will also be useful the genetic counseling and prenatal diagnosis.
Two Novel Β-Thalassemia Gene Mutations Were Detected in Chinese Patients: CD13/14(-C) and Beta Nt1582(a>g), PolyA(AATAAA>GATAAA)

Xiao-ying PAN,Bin TANG,Ju-qing LIANG,Hong-yi GAO,Ai-hua YIN,Jing WU,Ji-cheng WANG,Yan-fang ZHONG,Wei-jie ZHU

2009-01-01

Abstract:Objective: To identify two novel β-thalassemia gene mutations in Chinese patients: CD13/14 (-C) and beta nt1582 (A>G), PolyA (AATAAA>GATAAA). Methods: Ten suspected cases were selected in the prenatal diagnosis center for further diagnosing β-thalassemia. Among them, 7 cases were suspected as β-thalassemia trait, 1 case was suspected as β-thalassemia major, and 2 cases were fetus whose parents were β-thalassemia gene carriers. The samples were determined by using polymerase chain reaction and reverse dot blot hybridization (PCR-RDB) techniques, and β-hemoglobin direct genomic sequencing (DGS). Results: Two types of common β-thalassemia gene mutations were detected with PCR-RDB in 3 patients and 1 fetus, which were IVS-2-654 (C>T) and-28 (A>G). Five types of rare β-thalassemia gene mutations were detected with DGS in 6 patients and 1 fetus. Among these 5 rare gene mutations, 2 novel gene mutations had been found, which were beta nt 1582 (A>G), PolyA(AATAAA>GATAAA) and CD 13/14(-C). Conclusion: Two novel β-thalassemia gene muta-tions were detected, which phenotype would be β+ or β0. If a suspected case couldn't be identified by PCR-RDB, DNA sequencing should be used for further investigation.
Two Novel Deletion Mutations in Β-Globin Gene Cause Β-Thalassemia Trait in Two Chinese Families

Xiuqin Bao,Danqing Qin,Jicheng Wang,Jing Chen,Cuize Yao,Jie Liang,Kailing Liang,Yixia Wang,Yousheng Wang,Li Du,Aihua Yin

DOI: https://doi.org/10.1186/s40246-023-00559-4

2023-01-01

Human Genomics

Abstract:β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.
A new mutation in IVS-1 of the human β globin gene causing β thalassemia due to abnormal splicing

F Atweh By George, Wong Corinne, Reed Robin, Zhu Ding-er, Maniatis Tom, Kazazian Haig H Jr

1987-07-01

Abstract:A G to T transversion at the fifth nucleotide of the first intervening sequence (IVS-1) of the β-globin gene has been identified in cloned β-thalassemia genes of two unrelated individuals, one of Mediterranean and the other of Anglo Saxon ancestry. In each patient the mutation was present in a different β globin gene framework, defined by intra-genic restriction site polymorphisms, thereby suggesting the occurrence of independent mutations. The study of the RNA products of one of these cloned genes, after transfer and transient expression in HeLa cells, showed partial inactivation of the normal donor splice site of IVS-1 and activation of two major and one minor cryptic splice sites. Only one of the two major cryptic sites was utilized in a cell-free splicing extract. The effects of this mutation on messenger RNA (mRNA) splicing are similar to that of another β thalassemia gene with a G to C transition at the same position. © …
Detection of Beta-Thalassemia Mutations in the Chinese Using Amplified Dna from Dried Blood Specimens

Shu-zhen Huang,Xia-di Zhou,Hao Zhu,Zhao-rui Ren,Yi-tao Zeng

DOI: https://doi.org/10.1007/bf00208926

1990-01-01

Human Genetics

Abstract:This paper describes DNA polymerase chain reaction (PCR) amplification directly from dried blood specimens for the detection of the β-thalassemia mutation in China. Target DNA was amplified to span the β-globin gene regions, which included ten types of mutation sites specific for Chinese β-thalassemias. Ten kinds of oligonucleotide probes were constructed and used to hybridize with the amplified DNA. A total of 170 β-thalassemia alleles originating from eastern, southwestern and southern China were analyzed. The results revealed that the distributions of different types of mutations were different in the three regions. The most common types in southern China were a frameshift at codons 41/42 and a C→T substitution at IVS II n.654, the most frequent types in south-western China were codon 17 and IVS II n.654 mutations, and the predominant mutations in eastern China were frameshifts at codons 41/42 and 71/72.
Identification of Two Novel β-Thalassemia Mutations (HBB: c.335-346del and HBB: c.108 C > G) in Han Chinese

wenjuan wang,qian wang,tingting tao,aining sun,changgeng ruan,suning chen

DOI: https://doi.org/10.3109/03630269.2015.1049703

2015-01-01

Hemoglobin

Abstract:beta-Thalassemia (beta-thal) is an inherited blood disorder characterized by reduced or absent synthesis of the beta chains of hemoglobin (Hb). Although a number of causative mutations have been reported, here we report two novel mutations detected in Chinese patients. Red blood cell (RBC) indices were indicative of beta-thal, but no mutations were detected by routine methods. Sequencing of the beta-globin gene uncovered one mutant with a 12 bp deletion (TCTGTGTGCTGG) from codon 111 to codon 115 (HBB: c.335-346del12bp) in exon 3. The other was found to be a nonsense mutation at codon 35 (HBB: c. 108 C > G). The identification of these novel mutations will facilitate future diagnoses of beta-thal caused by either of these mutations and will also be useful for genetic counseling and prenatal diagnosis.
A Novel Mutation at HBA1: c.349G>T Causing α-Thalassemia in a Chinese Family

Zhenzhen Yin,Yuqi Hao,Xiaoyan Huang,Xiaohang Chen,Shiping Chen,Gaochi Li,Chuyan Chen,Fengxiang Wei

DOI: https://doi.org/10.1080/03630269.2021.1925292

Hemoglobin

Abstract:α-Thalassemia (α-thal) is one of the most common genetic diseases in Southern China. Although more than 300 α-thal mutations have been reported in the world, the mutation spectrum is still not comprehensive. In this study, a novel mutation (HBA1: c.349G>T) in a newborn (proband) was first found by next-generation sequencing (NGS). Subsequently, hematological analysis and thalassemia genetic testing were performed for the family members. The results showed that both the proband and her mother were heterozygotes for this novel mutation and presented abnormal hematological indices. Based on the features observed in clinical practice, this novel mutation was considered as a type of α-thal variation.
Genetic and phenotypic analysis of a rare asymptomatic case of a homozygous Chinese Gγ+(Aγδβ)0-thalassemia deletion in a Chinese family.

Li Du,Danqing Qin,Jicheng Wang,Lihua Yu,Cuize Yao,Ling Liu,Yanxia Zhang,Tingting Hu,Tenglong Yuan,Jie Liang,Aihua Yin

DOI: https://doi.org/10.1016/j.clinbiochem.2019.11.003

IF: 3.625

2019-01-01

Clinical Biochemistry

Abstract:OBJECTIVE:The clinical and hematologic features of thalassemia are due to different factors, and patients with identical genotypes may regularly exhibit variable severity. In the present work, one homozygous Chinese Gγ+(Aγδβ)0-thalassemia case with an asymptomatic phenotype, which is contrary to traditional views, was identified. Analysis of the underlying causes of this rare clinical phenotype involved accurate genetic diagnosis and detection of several genetic modifications. METHODS:Six members of the proband's family were enrolled in the study. Hematological parameters and hemoglobin analysis results were recorded. A suspension-array system, multiplex gap-polymerase chain reaction (gap-PCR) and multiplex ligation-dependent probe amplification (MLPA) were used together to characterize genotypes. Sanger sequencing was utilized to examine the KLF1 gene and four primary fetal hemoglobin (Hb F)-associated single-nucleotide polymorphisms (SNPs). RESULTS:Four family members carried the Chinese Gγ+(Aγδβ)0-thalassemia mutation, and a homozygous state was ultimately diagnosed for the proband. All of the Chinese Gγ+(Aγδβ)0 mutation-positive cases were coinherited with the Southern Asian α-thalassemia deletion (- - SEA/αα). Two SNP variants, rs7776054 and rs9399137, in the HBS1L-MYB locus were detected in the proband. CONCLUSIONS:Thus far, this is the first study to describe the molecular characterization of a homozygous Chinese Gγ+(Aγδβ)0-thalassemia patient who exhibits no clinical symptoms. Our findings suggest that coinheritance of α-thalassemia or HBS1L-MYB locus variants may affect the clinical severity of Chinese Gγ+(Aγδβ)0-thalassemia. We conclude that the molecular examination of genetic determinants known to be associated with clinical outcomes in Chinese Gγ+(Aγδβ)0-thalassemia should be emphasized.
First Report of Filipino β0-Thalassemia/β-Thalassemia in a Chinese Family

Meihuan ChenAixiang LvSiwen ZhangJunhao ZhengMin ZhangLingji ChenQianqian HeJianlong ZhuangNa LinLiangpu XuHailong Huanga Medical Genetic Diagnosis and Therapy Center,Fujian Maternity and Child Health Hospital,College of Clinical Medicine for Obstetrics & Gynecology and Pediatrics,Fujian Medical University,Fujian Provincial Key Laboratory of Prenatal Diagnosis and Birth Defect,Fuzhou,Chinab The School of Medical Technology and Engineering,Fujian Medical University,Fuzhou,Chinac Prenatal Diagnosis Center,Quanzhou Women's and Children's Hospital,Quanzhou,China

DOI: https://doi.org/10.1080/03630269.2023.2301487

2024-01-10

Hemoglobin

Abstract:A pregnant woman living in Fujian Province, southeastern China, presented due to a risk of having a baby with β-thalassemia major, during her second pregnancy, since she and her husband were suspected as β-thalassemia carriers and their affected daughter was a transfusion-dependent patient. Using the common α-thalassemia and β-thalassemia genotypes test, the pregnant woman was diagnosed as a β-thalassemia carrier with β IVS−2 − 654 (C→T) /β N genotype and her daughter had a homozygosity for IVS − 2 − 654 (C→T) mutation, however, no abnormalities were detected in her husband. SMRT identified a Filipino β 0 -deletion in her husband, and MLPA also revealed an unknown deletion in the HBB gene. Electrophoresis showed approximately 350 bp of the PCR product, and the β-Filipino genotype presented novel fracture fragments ranging from 5,112,884 to 5,231,358 bp, and lacked a 118,475 bp fragment relative to the wild-type sequence. The daughter was therefore diagnosed with the β IVS−2 − 654 (C→T) /β Filipino genotype. Prenatal diagnosis with umbilical cord blood at 27th week of gestation showed heteroztgosity for IVS − 2 − 654 (C→T) mutation in the fetus and continued pregnancy was recommended. In conclusion, we identified the Filipino β 0 -deletion in a Chinese family, from Fujian area, for the first time, during prenatal screening.

biochemistry & molecular biology,hematology
Splice Acceptor Mutation [HBB:c.93-2A > T] in a Patient with Hb S/β0-Thalassemia

John S. Waye,Meredith Hanna,Lisa Nakamura,Lynda Walker,Barry Eng,Landry E. Nfonsam

DOI: https://doi.org/10.1080/03630269.2024.2314075

2024-02-17

Hemoglobin

Abstract:We report a case of Hb S/β 0 -thalassemia (Hb S/β 0 -thal) in a patient who is a compound heterozygote for the Hb Sickle mutation ( HBB :c.20A > T) and a mutation of the canonical splice acceptor sequence of IVS1 (AG > TG, HBB :c.93-2A > T). This is the fifth mutation involving the AG splice acceptor site of IVS1, all of which prevent normal splicing and cause β 0 -thal.

biochemistry & molecular biology,hematology
Characterization of a novel HBB:c.194dup variant of the β-globin gene combined with six alpha genes

Jungao Huang,Le Ding,Junkun Chen,Shiping Chen,Peirun Tian,Jun Xie,Xiaoyan Huang,Xiaoqin Xin

DOI: https://doi.org/10.1177/03000605221099013

Abstract:β-thalassemia (β-thal) is one of the most prevalent inherited blood disorders in Ganzhou, south China. Next-generation sequencing was used to screen for thalassemia carriers in the general population. During the screening, we identified a novel β-thal variant in a 46-year-old Chinese man, which was validated by Sanger sequencing. Based on the patient's clinical data, this novel mutation was classified as severe β0. However, the patient was mildly anemic (hemoglobin, 89 g/L), which was inconsistent with typical β0 carrier characteristics. On further evaluation, quantitative PCR indicated the presence of six α genes, while molecular analysis and pedigree analysis revealed the coexistence of αααanti3.7 and αααanti4.2. Therefore, we report a novel β-thal variant combined with six α genes. We describe the patient's clinical phenotype and the process of molecular diagnosis. This case extends the spectrum of thalassemia variants.
A Triple-Heterozygous Β-Thalassemia Patient Demonstrated an Unusual Electrophoresis Pattern Due to a Novel Β0 Mutation [an IVS-II-654 (C>T) Mutation with a Hb Zürich-Langstrasse (HBB: C.151a>t) Mutation in Cis]

Juan Liao,Qin Li,Li-Qin Ling,Chao-Nan Liu,Xun-Bei Huang,Jing Zhou

DOI: https://doi.org/10.1080/03630269.2022.2072322

2022-01-01

Hemoglobin

Abstract:β-Thalassemia (β-thal) is caused by mutations on the β-globin genes, causing reduced (β+) or absent (β0) synthesis of the β chains of hemoglobin (Hb). In this report, a 28-year-old male patient with anemia and jaundice, was diagnosed with triple-heterozygous β-thal [an IVS-II-654 (C>T) mutation, a Hb Zürich-Langstrasse (HBB: c.151A>T) mutation and a Hb G-Siriraj (HBB: c.22G>A) mutation] by gene sequencing. However, his electrophoresis pattern was unusual: 90.8% Hb G-Siriraj, 5.9% Hb A2, 3.3% Hb F, no Hb A, no Hb Zürich-Langstrasse. His mother carried a β-thal trait (βA/βIVS-II-654) having mild anemia, with a classical electrophoresis pattern (95.1% Hb A, 4.4% Hb A2, 0.5% Hb F). His father was heterozygous for Hb G-Siriraj (βA/βG-Siriraj) but asymptomatic, with a corresponding electrophoresis pattern (63.9% Hb A, 3.5% Hb A2, 32.6% Hb G-Siriraj). In view of the family study results, the Hb Zürich-Langstrasse mutation in the proband was considered a de novo mutation occurring on the βIVS-II-654 allele that he inherited from his mother, resulting in a βIVS-II-654/Hb Zürich-Langstrasse genotype, which should be interpreted as a novel β0 mutation. This report illustrates that mutations in cis can confound genotype-phenotype correlations, therefore, just as DNA testing and Hb analysis, family study is also indispensable to the accurate identification of β-thal mutations.
Characterization of a novel 8.2 kb deletion causing beta-thalassemia

Ge Wang,Haoyang Huang,Li Chen,Qizhi Xiao,Wei Zhang,Qianqian Zhang

DOI: https://doi.org/10.1016/j.clinbiochem.2024.110832

2024-10-05

Abstract:Background: Thalassemia is a prevalent monogenic blood disorder, clinically classified into alpha- and beta-thalassemia, characterized by the imbalance of the alpha- and beta-globin chains that constitute adult hemoglobin. Copy number variations (CNVs) and single nucleotide variants in globin genes are the primary genetic defects causing thalassemia. Case report: During a prenatal examination, a pregnant woman was suspected to be a carrier of thalassemia, exhibiting microcytic hypochromic anemia and abnormal hemoglobin constituents. Gap-polymerase chain reaction (Gap-PCR) and reverse dot blot (PCR-RDB) techniques did not detect any common thalassemia mutations. We conducted hematological examination and further genetic analyses on the proband's family with three generations. Multiplex ligation-dependent probe amplification (MLPA) was employed to identify CNVs, targeted next-generation sequencing was used to screen for potential pathogenic variants, which were subsequently validated by Sanger sequencing. The hematological parameters of the proband, her father and her son all indicated they were beta-thalassemia carriers. MLPA results revealed a large deletion in beta-globin cluster. Further investigation confirmed the presence of a novel 8.2 kb deletion (NC_000011.10:g.5224208_5232469del) in the proband, her father, and her son, specifically covering the entire HBB gene while not impacting other globin genes. Conclusion: We found a novel 8.2 kb deletion leading to beta-thalassemia in a Chinese family in which three generations had been affected. This novel deletion may broaden the spectrum of known mutations in thalassemia and provide a reference for clinically suspected cases.
Molecular characterization of a Chinese pedigree with beta-thalassemia intermedia

Ge Huang,Wen-Ling Jiang,Ka-Bin Rong,Yun-Xiong Li,Xian-Ling Luo,Jin-Xiu Meng,Xi-Yong Yu

DOI: https://doi.org/10.3109/03630261003670226

Hemoglobin

Abstract:Hereditary persistence of fetal hemoglobin (HPFH), often associated with mutations in the beta-globin gene cluster, is normally benign, but a person carrying both HPFH and another beta-thalassemia (beta-thal) mutation will develop serious anemia. These people might be erroneously diagnosed as having homozygous beta-thal with common reverse dot-blot methods. Here we report a 5-year old boy with thalassemia intermedia, who is a compound heterozygote for the rare HPFH-6 deletion with codons 41/42 (-TCTT) beta(0)-thal, who inherited the deletion from his mother and the beta(41/42) mutation from his father.
A Novel 165 Kb Duplication Involving the α-Globin Gene Cluster Is Identified by Low-Pass Whole Genome Sequencing in a Chinese Thalassemia Intermedia Patient

Xiaohong HePeirun TianLijuan ZhongShanshan PengShiping ChenLei PanYutao DuRui Zhanga Department of Medical Genetics and Prenatal Diagnosis,Baoan Women's and Children's Hospital,Jinan University,Shenzhen,Chinab BGI-Shenzhen,Shenzhen,Chinac Hebei Medical University,Shijiazhuang,China

DOI: https://doi.org/10.1080/03630269.2024.2346143

2024-05-02

Hemoglobin

Abstract:Copy number variations (CNVs) involving the α-globin gene cluster can lead to an imbalance in the proportion of α- and β-globin chains and consequently cause clinical symptoms of β-thalassemia. In our case, a 6-year-old boy, clinically diagnosed with β thalassemia intermedia, was admitted for further genetic diagnosis with his family. Targeted sequencing and third generation sequencing (TGS) were used to detect the possible variants of the thalassemia genes. Low-pass whole genome sequencing (lpWGS) was conducted to specify the exact location of relevant CNVs across the genome, which was then validated by multiplex ligation-dependent probe amplification.The results revealed that the patient had a heterozygous β 0 mutation of Codon17 (A > T) and a full duplication of the α-globin gene cluster, inherited from his mother and father, respectively. Besides, a novel point mutation within the 5′ untranslated region of β-Globin ( HBB : c. −175 (G > A) was only detected in the patient. This study suggests that lpWGS seems a powerful alternative to detect large CNVs related to thalassemia with second intention for more information of the breakpoints and a simultaneous genome-scale detection of other pathogenic CNVs.

biochemistry & molecular biology,hematology
Molecular Genetic Characteristics of a Family Which Coinheritance of Rare-88 C>G ( HBB:c.-138 C>G) Β-Thalassemia Mutation with Α-Thalassemia and Review of the Literature

W Li,L T Chen,Y Yu,J Wang,C Y Li,T E Cai,C J Lu,D X Li,X J Tian

DOI: https://doi.org/10.3760/cma.j.cn112150-20220818-00823

2023-01-01

Abstract:The molecular genetic characteristics of a family with rare -88 C>G (HBB: c.-138 C>G) β-thalassemia gene mutation were studied using cohort study. The cohort study was conducted from June to August 2022 by Prenatal Diagnosis Center of Sanya Women and Children's Hospital Managed by Shanghai Children's Medical Center. The phenotype and genotype were analyzed by hematological cytoanalyzer, automatic electrophoretic analysis system, and next-generation sequencing (NGS). And then, Sanger sequencing was used to verify the rare gene results. The results showed that the proband, her father, her uncle and her younger male cousin had discrete microcytosis (MCV 70.1 fl, 71.9 fl, 73.1 fl and 76.6 fl, respectively) and hypochromia (MCH 21.5 pg,22.0 pg,22.6 pg and 23.5 pg, respectively), elevated hemoglobin A2 level (5.3%, 5.4%, 5.4% and 5.5%, respectively), slightly elevated or normal fetal hemoglobin (Hb F), but no anemia. The proband was identified to have co-inherited ɑ-thalassemia (Hb Westmead gene heterozygous mutation, ɑwsɑ/ɑɑ) and β-thalassemia with a rare -88 C>G (HBB: c.-138 C>G) heterozygous mutation (β-88 C>G/βN). Her mother had the same α-thalassemia as the proband. Her father, her uncle and her younger male cousin had the same rare -88 C>G heterozygous mutations as the proband. While her grandmother and younger brother were not carrier of thalassemia. In conclusion, 4 cases of rare -88 C>G(HBB:c.-138 C>G) heterozygous mutation had been detected in a Chinese family. Carriers of this beta-thalassemia are clinically asymptomatic. This study enriches the knowledge of the thalassemia mutation spectrum in Chinese people and provides valuable information for genetic counseling, prenatal diagnosis, and prevention of thalassemia, providing a scientific basis for improving the quality of birth population and preventing birth defects.
Molecular Analysis of α/β-Thalassemia in A Southern Chinese Population

Bang-Ce Ye,Zhuanfong Zhang,Zhengsong Lei

DOI: https://doi.org/10.1089/gte.2006.0502

2007-01-01

Genetic Testing

Abstract:Thalassemia is endemic to many regions in southern China. The screening of severe determinants of thalassemia is of critical importance in management and control of thalassemia. We designed a protocol based on microarray technology to screen for a spectrum of α/β-globin gene mutations in the Chinese population. A total of 38 probes were capable of screening 98% of α/β-globin gene mutations in the China population, including 16 mutations of β-globin [β(41–42)(−TCTT), IVSII-654(C→T), β17(A→T), −28(A→G), β(71–72)(+A), β(71–72)(+T), HbE26(G→A), −29(A→G), β(27–28)(+C), IVSI-1(G→T), IVSI-5(G→C), β(14-15)(+G), IVSII-5(G→C), β41(+T), 37(G→A), and β43(G→T)] and five mutations of α/β[three deletions of −α;3.7, −α4.2, and −−SEA; two nondeletions of αQuong Sze codon α125(T→C) and αConstant Spring codon α142(T→C)]. Multiplex PCR products were amplified from human genomic DNA and allowed to hybridize with the oligonucleotide array. α/β-Globin genotypes were assigned by quantitative analysis of the hybridization results...
Identification of a Novel 7-Bp Deletion in the Α-Globin Gene Cluster in One Chinese Family.

Bo-Dan Wu,Xiao-Yan Zhou,Mei-Juan Xie,Chan-Chan Jin,Yuan-Long Yan,Jing He,Bao-Sheng Zhu,Jie Zhang

DOI: https://doi.org/10.1080/03630269.2023.2216890

2023-01-01

Hemoglobin

Abstract:Deletional α-thalassemia is characterized by reduced hemoglobin A2 and involves the deletion of a few nucleotides, which is a rare hereditary disease. However, the detection of rare mutations using commonly used genetic tests is highly challenging. In the present study, next-generation sequencing (NGS) was used to identify a novel 7-bp deletion α-thalassemia in one individual from a Chinese family. Hematological parameters of the family members were determined using an automated cell counter, and hemoglobin electrophoresis was performed using a capillary electrophoresis system. Subsequently, NGS was performed on the genomic DNA of the patient and her family members. The 7-bp deletion (named Hb Honghe [HBA1: c.401_407delGCACCGT]) of α-thalassemia in the α-globin gene was confirmed using Sanger sequencing. The patient's father was also a heterozygous carrier of HBA1: c.401_407delGCACCGT deletion, but not her mother or sister. The application of the combined molecular approach is essential for the accurate diagnosis of rare thalassemia. This study reports a novel case of α- thalassemia. The characterization of the mutation might provide new insights into genetic counseling and accurate diagnosis of thalassemia.

First Detection of the Splice Donor Site IVS-I-2 (T-->B) Beta-Thalassemia Mutation in a Chinese Patient.

Prevention of Hb Bart’s (γ4) Disease Associated with the – –Thaiα0-Thalassemia Deletion in Mainland China

A Rare Beta-Thalassaemia Mutation (C-T) at Position -90 of the Beta-Globin Gene Discovered in a Chinese Family.

Identification of a Novel Β-Thalassemia Mutation at Codon 130 (+T) (HBB: C.391inst) in Han Chinese.

Two Novel Β-Thalassemia Gene Mutations Were Detected in Chinese Patients: CD13/14(-C) and Beta Nt1582(a>g), PolyA(AATAAA>GATAAA)

Two Novel Deletion Mutations in Β-Globin Gene Cause Β-Thalassemia Trait in Two Chinese Families

A new mutation in IVS-1 of the human β globin gene causing β thalassemia due to abnormal splicing

Detection of Beta-Thalassemia Mutations in the Chinese Using Amplified Dna from Dried Blood Specimens

Identification of Two Novel β-Thalassemia Mutations (HBB: c.335-346del and HBB: c.108 C > G) in Han Chinese

A Novel Mutation at HBA1: c.349G>T Causing α-Thalassemia in a Chinese Family

Genetic and phenotypic analysis of a rare asymptomatic case of a homozygous Chinese Gγ+(Aγδβ)0-thalassemia deletion in a Chinese family.

First Report of Filipino β0-Thalassemia/β-Thalassemia in a Chinese Family

Splice Acceptor Mutation [HBB:c.93-2A > T] in a Patient with Hb S/β0-Thalassemia

Characterization of a novel HBB:c.194dup variant of the β-globin gene combined with six alpha genes

A Triple-Heterozygous Β-Thalassemia Patient Demonstrated an Unusual Electrophoresis Pattern Due to a Novel Β0 Mutation [an IVS-II-654 (C>T) Mutation with a Hb Zürich-Langstrasse (HBB: C.151a>t) Mutation in Cis]

Characterization of a novel 8.2 kb deletion causing beta-thalassemia

Molecular characterization of a Chinese pedigree with beta-thalassemia intermedia

A Novel 165 Kb Duplication Involving the α-Globin Gene Cluster Is Identified by Low-Pass Whole Genome Sequencing in a Chinese Thalassemia Intermedia Patient

Molecular Genetic Characteristics of a Family Which Coinheritance of Rare-88 C>G ( HBB:c.-138 C>G) Β-Thalassemia Mutation with Α-Thalassemia and Review of the Literature

Molecular Analysis of α/β-Thalassemia in A Southern Chinese Population

Identification of a Novel 7-Bp Deletion in the Α-Globin Gene Cluster in One Chinese Family.