Single-session supine bilateral percutaneous nephrolithotomy.

S. Proietti,G. Sortino,A. Giannantoni,M. Sofer,R. Peschechera,L. Luciani,G. Morgia,G. Giusti

DOI: https://doi.org/10.1016/j.urology.2014.10.036

IF: 2.633

2015-02-01

Urology

Abstract:

What problem does this paper attempt to address?

Characterization of a novel 8.2 kb deletion causing beta-thalassemia

Ge Wang,Haoyang Huang,Li Chen,Qizhi Xiao,Wei Zhang,Qianqian Zhang

DOI: https://doi.org/10.1016/j.clinbiochem.2024.110832

2024-10-05

Abstract:Background: Thalassemia is a prevalent monogenic blood disorder, clinically classified into alpha- and beta-thalassemia, characterized by the imbalance of the alpha- and beta-globin chains that constitute adult hemoglobin. Copy number variations (CNVs) and single nucleotide variants in globin genes are the primary genetic defects causing thalassemia. Case report: During a prenatal examination, a pregnant woman was suspected to be a carrier of thalassemia, exhibiting microcytic hypochromic anemia and abnormal hemoglobin constituents. Gap-polymerase chain reaction (Gap-PCR) and reverse dot blot (PCR-RDB) techniques did not detect any common thalassemia mutations. We conducted hematological examination and further genetic analyses on the proband's family with three generations. Multiplex ligation-dependent probe amplification (MLPA) was employed to identify CNVs, targeted next-generation sequencing was used to screen for potential pathogenic variants, which were subsequently validated by Sanger sequencing. The hematological parameters of the proband, her father and her son all indicated they were beta-thalassemia carriers. MLPA results revealed a large deletion in beta-globin cluster. Further investigation confirmed the presence of a novel 8.2 kb deletion (NC_000011.10:g.5224208_5232469del) in the proband, her father, and her son, specifically covering the entire HBB gene while not impacting other globin genes. Conclusion: We found a novel 8.2 kb deletion leading to beta-thalassemia in a Chinese family in which three generations had been affected. This novel deletion may broaden the spectrum of known mutations in thalassemia and provide a reference for clinically suspected cases.
Report of Two Novel Thalassemia Variants, HBB: c.181delG and HBA1: c.121_126delAAGACC, in Chinese Individuals

Xinping Chen,Zhangli Lin,Junjie Hu,Shiping Chen,Shu Wen,Aizhu Wu,Hong Wu,Jiali Huang,Hanqiang Wang,Jun Sun,Zhiyu Peng,Yan Sun,Shengmiao Fu

DOI: https://doi.org/10.1080/03630269.2021.1883646

Hemoglobin

Abstract:In this study, we report two novel thalassemia variants detected in Chinese individuals using targeted NGS technology. We detected a novel frameshift variant, HBB: c.181delG, in a 32-year-old Chinese individual. This novel variant [a single nucleotide deletion at nucleotide 181 of codon 60 (-G)], was detected by targeted next generation sequencing (NGS), resulting in a stop codon at codon 60 in exon 2 of the HBB gene. The impact of this novel variant was further analyzed by an in vitro model. We also identified a novel in-frame variant, HBA1: c.121_126delAAGACC [codons 40/41 (-AAGACC)], in another Chinese individual in this study. We named these two novel variants, HBB: c.181delG and HBA1: c.121_126delAAGACC according to the Human Genome Variation Society (HGVS), which were detected by the first author. These two novel variants have expanded the mutation spectrum of thalassemia and it would be beneficial for carrier screening, genetic counseling and prenatal diagnosis (PND) of thalassemia.
29th European Conference on Modelling and Simulation, ECMS 2015, Albena (Varna), Bulgaria, May 26-29, 2015. Proceedings

A. Varna,V. Mladenov,G. Spasov,P. Georgieva,G. Petrova,P. Petkov,S. Choi,Kang Park,J. H. Yang,H. Kang,Yicun Xu,Shouchen Pan,Dongchen Qin,Yingjia Wang,D. Pandya

DOI: https://doi.org/10.7148/2015

Abstract:
Efficacy of some antioxidants supplementation in reducing oxidative stress post sodium tungstate exposure in male wistar rats.

Sherry Sachdeva,S. Flora

DOI: https://doi.org/10.1016/j.jtemb.2014.01.004

IF: 3.995

2014-04-01

Journal of Trace Elements in Medicine and Biology

Abstract:
A Novel Mutation at HBA1: c.349G>T Causing α-Thalassemia in a Chinese Family

Zhenzhen Yin,Yuqi Hao,Xiaoyan Huang,Xiaohang Chen,Shiping Chen,Gaochi Li,Chuyan Chen,Fengxiang Wei

DOI: https://doi.org/10.1080/03630269.2021.1925292

Hemoglobin

Abstract:α-Thalassemia (α-thal) is one of the most common genetic diseases in Southern China. Although more than 300 α-thal mutations have been reported in the world, the mutation spectrum is still not comprehensive. In this study, a novel mutation (HBA1: c.349G>T) in a newborn (proband) was first found by next-generation sequencing (NGS). Subsequently, hematological analysis and thalassemia genetic testing were performed for the family members. The results showed that both the proband and her mother were heterozygotes for this novel mutation and presented abnormal hematological indices. Based on the features observed in clinical practice, this novel mutation was considered as a type of α-thal variation.
A Novel 165 Kb Duplication Involving the α-Globin Gene Cluster Is Identified by Low-Pass Whole Genome Sequencing in a Chinese Thalassemia Intermedia Patient

Xiaohong HePeirun TianLijuan ZhongShanshan PengShiping ChenLei PanYutao DuRui Zhanga Department of Medical Genetics and Prenatal Diagnosis,Baoan Women's and Children's Hospital,Jinan University,Shenzhen,Chinab BGI-Shenzhen,Shenzhen,Chinac Hebei Medical University,Shijiazhuang,China

DOI: https://doi.org/10.1080/03630269.2024.2346143

2024-05-02

Hemoglobin

Abstract:Copy number variations (CNVs) involving the α-globin gene cluster can lead to an imbalance in the proportion of α- and β-globin chains and consequently cause clinical symptoms of β-thalassemia. In our case, a 6-year-old boy, clinically diagnosed with β thalassemia intermedia, was admitted for further genetic diagnosis with his family. Targeted sequencing and third generation sequencing (TGS) were used to detect the possible variants of the thalassemia genes. Low-pass whole genome sequencing (lpWGS) was conducted to specify the exact location of relevant CNVs across the genome, which was then validated by multiplex ligation-dependent probe amplification.The results revealed that the patient had a heterozygous β 0 mutation of Codon17 (A > T) and a full duplication of the α-globin gene cluster, inherited from his mother and father, respectively. Besides, a novel point mutation within the 5′ untranslated region of β-Globin ( HBB : c. −175 (G > A) was only detected in the patient. This study suggests that lpWGS seems a powerful alternative to detect large CNVs related to thalassemia with second intention for more information of the breakpoints and a simultaneous genome-scale detection of other pathogenic CNVs.

biochemistry & molecular biology,hematology
Identification of a Novel 7-Bp Deletion in the Α-Globin Gene Cluster in One Chinese Family.

Bo-Dan Wu,Xiao-Yan Zhou,Mei-Juan Xie,Chan-Chan Jin,Yuan-Long Yan,Jing He,Bao-Sheng Zhu,Jie Zhang

DOI: https://doi.org/10.1080/03630269.2023.2216890

2023-01-01

Hemoglobin

Abstract:Deletional α-thalassemia is characterized by reduced hemoglobin A2 and involves the deletion of a few nucleotides, which is a rare hereditary disease. However, the detection of rare mutations using commonly used genetic tests is highly challenging. In the present study, next-generation sequencing (NGS) was used to identify a novel 7-bp deletion α-thalassemia in one individual from a Chinese family. Hematological parameters of the family members were determined using an automated cell counter, and hemoglobin electrophoresis was performed using a capillary electrophoresis system. Subsequently, NGS was performed on the genomic DNA of the patient and her family members. The 7-bp deletion (named Hb Honghe [HBA1: c.401_407delGCACCGT]) of α-thalassemia in the α-globin gene was confirmed using Sanger sequencing. The patient's father was also a heterozygous carrier of HBA1: c.401_407delGCACCGT deletion, but not her mother or sister. The application of the combined molecular approach is essential for the accurate diagnosis of rare thalassemia. This study reports a novel case of α- thalassemia. The characterization of the mutation might provide new insights into genetic counseling and accurate diagnosis of thalassemia.
Identification of a novel 10.3 kb deletion causing α 0 -thalassemia by the third-generation sequencing: pedigree analysis and genetic diagnosis

Runhong Xu,Hui Li,Song Yi,Jun Du,Jianguo Jin,Yayun Qin,Yufei Jiang,Tangxinzi Gao,Chengcheng Zhang,Meiqi Yi,Yinyin Liu,Wanli Meng,Jiaqi Li,Jieping Song

DOI: https://doi.org/10.1016/j.clinbiochem.2022.12.018

IF: 3.625

2023-01-05

Clinical Biochemistry

Abstract:Background α-thalassemia is an inherited blood disorder caused by variants in the α-globin gene cluster. Identification of the pathogenic α-globin gene variants is important for the diagnosis and management of thalassemia. Methods Two suspected families from Xiantao, Hubei Province were recruited in this study. The family members underwent hemoglobin testing. Polymerase Chain Reaction based reverse dot blot (PCR-RDB) was employed to identify the known variants. Next-generation sequencing (NGS) and the third-generation sequencing (TGS) were performed to screen the potential disease-causing variants, which were validated by Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA). Results Hematological analysis suggested that proband A had α-thalassemia traits, and proband B had HbH disease traits. However, only a -α 3.7 mutation had been detected by PCR-RDB and NGS in the proband of family B. Subsequent TGS identified a novel 10.3 kb deletion (NC_000016.10:g.172342-182690del) covering the HBA1 , HBQ1 and HBA2 genes in the α-globin gene cluster in both family A and B, which was confirmed by Sanger sequencing and MLPA. These results indicated that the novel deletion is likely responsible for α-thalassemia. Conclusion A novel α-thalassemia deletion was identified for the two families by TGS. Our work broadened the molecular spectrum of α-thalassemia, and was beneficial for the diagnosis, genetic counseling and management of α-thalassemia.

medical laboratory technology
Light and Temperature Cycles as Zeitgebers of Zebrafish (Danio rerio) Circadian Activity Rhythms

J. López-Olmeda,J. Madrid,F. Sánchez‐Vázquez

DOI: https://doi.org/10.1080/07420520600651065

2006-01-01

Chronobiology International

Abstract:Light and temperature cycles are the most important synchronizers of biological rhythms in nature. However, the relative importance of each, especially when they are not in phase, has been poorly studied. The aim of this study was to analyze the entrainment of daily locomotor activity to light and/or temperature cycles in zebrafish. Under two constant temperatures (20°C and 26°C) and 12:12 light-dark (LD) cycles, zebrafish were most active during the day (light) time and showed higher total activity at the warmer temperature, while diurnalism was higher at 20°C than at 26°C (87% and 77%, respectively). Under thermocycles (12:12 LD, 26:20°C thermophase:chryophase or TC), zebrafish daily activity synchronized to the light phase, both when the thermophase and light phase were in phase (LD/TC) or in antiphase (LD/CT). Under constant dim light (3 lux), nearly all zebrafish synchronized to thermocycles (τ=24 h), although activity rhythms (60% to 67% of activity occurred during the thermophase) were not as marked as those observed under the LD cycle. Under constant dim light of 3 lux and constant temperature (22.5°C), 4 of 6 groups of zebrafish previously entrained to thermocycles displayed free‐running rhythms (τ=22.9 to 23.6 h). These results indicate that temperature cycles alone can also entrain zebrafish locomotor activity.
Severe Thalassemia Caused by Hb Zunyi [β147(HC3)Stop→Gln; HBB: c.442T>C)] on the β-Globin Gene

Qiong Su,Shiping Chen,Liusong Wu,Runmei Tian,Xiaoqin Yang,Xiaoyan Huang,Yan Chen,Zhiyu Peng,Jindong Chen

DOI: https://doi.org/10.1080/03630269.2019.1582430

Hemoglobin

Abstract:Hemoglobinopathies are caused by genetic defects on the globin genes. To date, more than 900 β-globin variants have been recorded worldwide. These gene alterations often cause either a decrease in β-globin synthesis or completely block synthesis, leading to a hemoglobinopathy. While most of these causative mutations are inherited, de novo mutations are quite rare. Here, we investigated three hemoglobinopathy cases. These patients developed severe hemolytic anemia at 3-5 months of age and were transfusion-dependent. In patient 1, a novel β variant, Hb Zunyi [β147(HC3)Stop→Gln; HBB: c.442T>C] was identified. This de novo mutation results in a stop codon substitution to a glutamine residue at codon 147 of the β-globin gene, and leads to severe thalassemia. In patient 2, we discovered the rare Hb Southampton mutation [β106(G8)Leu→Pro; HBB: c.320T>C], while in patient 3, the rare Hb Alesha mutation [β67(E11)Val→Met (GTG>ATG); HBB: c.202G>A] was detected. The identification of the novel β variant, Hb Zunyi, has added to the human globin database and will shed light on future diagnosis of hemoglobinopathy/thalassemia and genetic counseling.
AB034. Hemoglobinopathies in China and SEA: Rapid Targeted Deep Sequencing for Molecular Screening and Clinical Genotyping in Subjects with Hemoglobinopathies

Ming Qi

DOI: https://doi.org/10.3978/j.issn.2305-5839.2015.ab034

IF: 3.616

2015-01-01

Annals of Translational Medicine

Abstract:Hemoglobin disorder is one of the most common birth defects in the world. α and β thalassemia are prevalent in tropical and subtropical regions. The imbalance of α and β hemoglobin is the pathological mechanism and the base of clinical classification of α and β thalassemia. In Southern China, 17 gross deletions account for 70-80%, and 13 point mutations, for 20-30% of α-thalassemia. Fifty-two point mutations account for 97% for β-thalassemia. Six deletions cause δβ-thalassemia or HPFH. Fetal hemoglobin levels are regulated by multiple modifier genes which influences the severity of thalassemia. NGS technology helps significantly the effectiveness of molecular diagnosis and better understanding of the diseases.
Immunoadsorption as treatment option in dilated cardiomyopathy

S. Felix,A. Staudt

DOI: https://doi.org/10.1080/08916930802031173

IF: 3.5

2008-01-01

Autoimmunity

Abstract:Abnormalities of the cellular and humoral immune system have been described in patients with dilated cardiomyopathy (DCM). Various circulating cardiac autoantibodies have been detected among DCM patients. Circulating antibodies are extractable by immunoadsorption (IA). Recent open controlled pilot studies have consequently shown that removal of circulating antibodies by IA induces improvement of cardiac function in DCM. IA, furthermore, decreases myocardial inflammation. In vitro data indicate that cardiodepressive antibodies play an important role in cardiac dysfunction of DCM patients; removal of these antibodies may accordingly represent the essential mechanism of IA in DCM. Furthermore, detection of cardiodepressive antibodies predicts hemodynamic benefits during IA. These antibodies belong to immunoglobulin G subclass 3. Recent data indicate that newly detected sarcolemmal Fcγ receptors IIa are involved in the functional effects of cardiac autoantibodies.
Hemoglobin H disease due to a de novo mutation at the α2-globin gene and an inherited common α-thalassemia deletion found in a Chinese boy

Chunjiang Zhu,Wenfang Yu,Jiansheng Xie,Ling Chen,Hui Ding,Xuan Shang,Xiangmin Xu

DOI: https://doi.org/10.1016/j.bcmd.2010.07.005

2010-10-15

Abstract:Hemoglobin (Hb) H disease is a moderate form of α-thalassemia resulting from various genetic defects. A novel frameshift mutation cd 43/44(-C) at the α2-globin gene was identified in a Chinese boy with hemoglobin H disease by sequencing. The proband's mother carries a common α-thalassemia deletion while his father was normal both in the hematological phenotype and α-globin genotype, which suggested that it occurred as a de novo mutation. Molecular studies revealed a compound heterozygote for the Southeast Asian α-thalassemia deletion and this novel spontaneous mutation (-/α(T)α) and the patient exhibited the clinical manifestation of classic hemoglobin H disease. Based on the results of excluding the possibility of a somatic mosaicism of a point mutation in the α2-globin gene, we progress that this de novo single-base deletion should have arisen during the spermatogenic process or earlier embryonic stage. The present study provides information in determining a supplementary model of inheritance for α-thalassemia, which should be useful in genetic counseling.
Third‐generation sequencing identified two rare α‐chain variants leading to hemoglobin variants in Chinese population

Jianlong Zhuang,Yuying Jiang,Yu'e Chen,Aiping Mao,Junwei Chen,Chunnuan Chen

DOI: https://doi.org/10.1002/mgg3.2365

2024-01-23

Molecular Genetics & Genomic Medicine

Abstract:Abstract Background Rare and novel variants of HBA1/2 and HBB genes resulting in thalassemia and hemoglobin (Hb) variants have been increasingly identified. Our goal was to identify two rare Hb variants in Chinese population using third‐generation sequencing (TGS) technology. Methods Enrolled in this study were two Chinese families from Fujian Province. Hematological screening was conducted using routine blood analysis and Hb capillary electrophoresis analysis. Routine thalassemia gene testing was carried out to detect the common mutations of α‐ and β‐thalassemia in Chinese population. Rare or novel α‐ and β‐globin gene variants were further investigated by TGS. Results The proband of family 1 was a female aged 32, with decreased levels of mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), Hb A2, and abnormal Hb bands in zone 5 and zone 12. No common thalassemia mutations were detected by routine thalassemia analysis, while a rare α‐globin gene variant Hb Jilin [α139(HC1)Lys>Gln (AAA>CAA); HBA2:c.418A>C] was identified by TGS. Subsequent pedigree analysis showed that the proband's son also harbored the Hb Jilin variant with slightly low levels of MCH, Hb A2, and abnormal Hb bands. The proband of family 2 was a male at 41 years of age, exhibiting normal MCV and MCH, but a low level of Hb A2 and an abnormal Hb band in zone 12 without any common α‐ and β‐thalassemia mutations. The subsequent TGS detection demonstrated a rare Hb Beijing [α16(A14)Lys>Asn (AAG>AAT); HBA2:c.51G>T] variant in HBA2 gene. Conclusion In this study, for the first time, we present two rare Hb variants of Hb Jilin and Hb Beijing in Fujian Province, Southeast China, using TGS technology.

genetics & heredity
Five novel globin gene mutations identified in five Chinese families by next-generation sequencing

Jie Zhang,Meijuan Xie,Zhiyu Peng,Xiaoyan Zhou,Tingting Zhao,Chanchan Jin,Yuanlong Yan,Xiaohong Zeng,Dongmei Li,Yangjia Zhang,Jie Su,Na Feng,Jing He,Xiangmei Yao,Tao Lv,Baosheng Zhu

DOI: https://doi.org/10.1002/mgg3.1835

Abstract:Background: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of β-thalassemia caused by five different mutations in the globin gene. Methods: Next-generation sequencing (NGS) was used to identify novel α- and β-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. Results: NGS revealed five novel cases of α- and β-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed. Conclusion: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.
Newborn Screening for β-Thalassemia Identifies a Complex Genotype Involving a Novel β-Globin Gene Mutation (HBB:c.336dup)

John S. Waye,Meredith Hanna,Betty-Ann Hohenadel,Lisa Nakamura,Lynda Walker,Barry Eng,Landry E. Nfonsam

DOI: https://doi.org/10.1080/03630269.2024.2328220

2024-04-03

Hemoglobin

Abstract:Newborn screening identified a Chinese-Canadian infant who was positive for possible β-thalassemia (β-thal). Detailed family studies demonstrated that the proband was a compound heterozygote for the Chinese G γ( A γδβ) 0 -thal deletion and a novel frameshift mutation within exon 3 ( HBB :c.336dup), and heterozygous for the Southeast Asian α-thal deletion (−− SEA /αα). This case illustrates the importance of follow-up molecular testing of positive newborn screening results to confirm the diagnosis and define risks for future pregnancies.

biochemistry & molecular biology,hematology
Case report: Identification of a novel triplication of alpha-globin gene by the third-generation sequencing: pedigree analysis and genetic diagnosis

Yujiao Chen,Tiantian Xie,Minhui Ma,Juan Yang,Yihang Lv,Xudong Dong

DOI: https://doi.org/10.1080/16078454.2023.2277571

IF: 2.264

Hematology

Abstract:Background: Thalassemia, a common autosomal hereditary blood disorder worldwide, mainly contains α- and β-thalassemia. The α-globin gene triplicates allele is harmless for carriers, but aggravates the phenotype of β-thalassemia. Therefore, it is particularly crucial to accurately detect the structural variants of α-globin gene clusters. Case report: We reported a 28-year-old man, the proband, with microcytic hypochromic anemia. From pedigree analysis, his mother and sister had hypochromic microcytosis, and his father was normal. Genetic testing of thalassemia identified a novel α-globin gene triplicate named αααanti4.2del726bp (NC_000016.10:g.170769_174300dupinsAAAAAA) by third-generation sequencing (TGS) in the proband and his father, which was further validated by multiplex ligation-dependent probe amplification (MLPA) and Sanger sequencing. The genotypes of the proband's mother and sister were both -α3.7/αα compounded with heterozygous HBB:c.126_129delCTTT. They were categorized as silent α-thalassemia with co-inheritance of β-thalassemia trait. The proband's genotype additionally had the α-globin gene triplicates compared with his mother and sister, which increased the imbalance between α/β-globin, so the proband had more severe hematological parameters. The proband's wife was diagnosed as HBA2:c.427T > C heterozygosis, and his daughter had the novel α-globin gene triplicates compounded with HBA2:c.427T > C, therefore the girl might be asymptomatic. Conclusion: The identification of the novel α-globin gene triplicates provides more insight for the research of thalassemia variants and indicates that TGS has signiﬁcant advantages on genetic testing of thalassemia for the reliability, accuracy and comprehensiveness.
Third-generation sequencing identified a novel complex variant in a patient with rare alpha-thalassemia

Cong Zhou,Yepei Du,Haixia Zhang,Xing Wei,Rui Li,Jing Wang

DOI: https://doi.org/10.1186/s12887-024-04811-1

2024-05-13

Abstract:Background: Thalassemias represent some of the most common monogenic diseases worldwide and are caused by variations in human hemoglobin genes which disrupt the balance of synthesis between the alpha and beta globin chains. Thalassemia gene detection technology is the gold standard to achieve accurate detection of thalassemia, but in clinical practice, most of the tests are only for common genotypes, which can easily lead to missing or misdiagnosis of rare thalassemia genotypes. Case presentation: We present the case of an 18-year-old Chinese female with abnormal values of routine hematological indices who was admitted for genetic screening for thalassemia. Genomic DNA was extracted and used for the genetic assays. Gap polymerase chain reaction and agarose gel electrophoresis were performed to detect HBA gene deletions, while PCR-reverse dot blot hybridization was used to detect point mutations in the HBA and HBB genes. Next-generation sequencing and third-generation sequencing (TGS) were used to identify known and potentially novel genotypes of thalassemia. We identified a novel complex variant αHb WestmeadαHb Westmeadαanti3.7/-α3.7 in a patient with rare alpha-thalassemia. Conclusions: Our study identified a novel complex variant that expands the thalassemia gene variants spectrum. Meanwhile, the study suggests that TGS could effectively improve the specificity of thalassemia gene detection, and has promising potential for the discovery of novel thalassemia genotypes, which could also improve the accuracy of genetic counseling. Couples who are thalassemia carriers have the opportunity to reduce their risk of having a child with thalassemia.
Identification of a Novel Variant c.163delG in HBB Gene Resulting in a Beta Null Phenotype in a Proband with Thalassemia Intermedia

M. Mamata,G. Padma,T. Pragna Laxmi,K. Saroja,Dalal Ashwin,Jain Suman

DOI: https://doi.org/10.1080/03630269.2023.2279609

2024-01-24

Hemoglobin

Abstract:A 21-year-old patient presented with a previous medical history of pallor, mild icterus, increased fatigue, low hemoglobin, and abnormal hemoglobin variant analysis with more than 70 transfusions. He was referred for genetic analysis to identify the pathogenic variations in the β-globin gene. Sanger's sequencing of the proband and his family revealed the presence of a novel frame shift variant HBB:c.163delG in a compound heterozygous state with hemoglobin E (HbE) (HBB:c.79G > A) variant. The father and the sibling of the patient were found to be normal for the HBB gene. Mother was found to be heterozygous for HbE (HBB:c.79G > A ) variant. In silico analysis by Mutalyzer predicted that c.163delG variant generated a premature stop codon after seven codons, leading to a truncated protein. FoldX protein stability analysis showed a positive ΔΔG value of 45.27 kcal/mol suggesting a decrease in protein stability. HBB : c.79G > A is a known variant coding for HbE variant, which results in the reduced synthesis of β-globin chain and shows mild thalassemia. Combined effect of HBB:c.163delG and HBB:c.79G > A variants in the proband might have led to the reduced synthesis of β-globin chains resulting in a thalassemia intermedia type of clinical manifestation.

biochemistry & molecular biology,hematology
Case report: A novel 10.8-kb deletion identified in the β-globin gene through the long-read sequencing technology in a Chinese family with abnormal hemoglobin testing results

Mingkun Shao,Yaoyao Wan,Weipeng Cao,Juan Yang,Di Cui,Minhui Ma,Wanqin Hu

DOI: https://doi.org/10.3389/fmed.2023.1192279

2023-07-13

Abstract:Background: Thalassemia is a common inherited hemoglobin disorder caused by a deficiency of one or more globin subunits. Substitution variants and deletions in the HBB gene are the major causes of β-thalassemia, of which large fragment deletions are rare and difficult to be detected by conventional polymerase chain reaction (PCR)-based methods. Case report: In this study, we reported a 26-year-old Han Chinese man, whose routine blood parameters were found to be abnormal. Hemoglobin testing was performed on the proband and his family members, of whom only the proband's mother had normal parameters. The comprehensive analysis of thalassemia alleles (CATSA, a long-read sequencing-based approach) was performed to identify the causative variants. We finally found a novel 10.8-kb deletion including the β-globin (HBB) gene (Chr11:5216601-5227407, GRch38/hg38) of the proband and his father and brother, which were consistent with their hemoglobin testing results. The copy number and exact breakpoints of the deletion were confirmed by multiplex ligation-dependent probe amplification (MLPA) and gap-polymerase chain reaction (Gap-PCR) as well as Sanger sequencing, respectively. Conclusion: With this novel large deletion found in the HBB gene in China, we expand the genotype spectrum of β-thalassemia and show the advantages of long-read sequencing (LRS) for comprehensive and precise detection of thalassemia variants.

Single-session supine bilateral percutaneous nephrolithotomy.

Characterization of a novel 8.2 kb deletion causing beta-thalassemia

Report of Two Novel Thalassemia Variants, HBB: c.181delG and HBA1: c.121_126delAAGACC, in Chinese Individuals

29th European Conference on Modelling and Simulation, ECMS 2015, Albena (Varna), Bulgaria, May 26-29, 2015. Proceedings

Efficacy of some antioxidants supplementation in reducing oxidative stress post sodium tungstate exposure in male wistar rats.

A Novel Mutation at HBA1: c.349G>T Causing α-Thalassemia in a Chinese Family

A Novel 165 Kb Duplication Involving the α-Globin Gene Cluster Is Identified by Low-Pass Whole Genome Sequencing in a Chinese Thalassemia Intermedia Patient

Identification of a Novel 7-Bp Deletion in the Α-Globin Gene Cluster in One Chinese Family.

Identification of a novel 10.3 kb deletion causing α 0 -thalassemia by the third-generation sequencing: pedigree analysis and genetic diagnosis

Light and Temperature Cycles as Zeitgebers of Zebrafish (Danio rerio) Circadian Activity Rhythms

Severe Thalassemia Caused by Hb Zunyi [β147(HC3)Stop→Gln; HBB: c.442T>C)] on the β-Globin Gene

AB034. Hemoglobinopathies in China and SEA: Rapid Targeted Deep Sequencing for Molecular Screening and Clinical Genotyping in Subjects with Hemoglobinopathies

Immunoadsorption as treatment option in dilated cardiomyopathy

Hemoglobin H disease due to a de novo mutation at the α2-globin gene and an inherited common α-thalassemia deletion found in a Chinese boy

Third‐generation sequencing identified two rare α‐chain variants leading to hemoglobin variants in Chinese population

Five novel globin gene mutations identified in five Chinese families by next-generation sequencing

Newborn Screening for β-Thalassemia Identifies a Complex Genotype Involving a Novel β-Globin Gene Mutation (HBB:c.336dup)

Case report: Identification of a novel triplication of alpha-globin gene by the third-generation sequencing: pedigree analysis and genetic diagnosis

Third-generation sequencing identified a novel complex variant in a patient with rare alpha-thalassemia

Identification of a Novel Variant c.163delG in HBB Gene Resulting in a Beta Null Phenotype in a Proband with Thalassemia Intermedia

Case report: A novel 10.8-kb deletion identified in the β-globin gene through the long-read sequencing technology in a Chinese family with abnormal hemoglobin testing results