Abstract:Objective More and more attention has been given to the presumption that glioma stem cells (GSCs) originate from neural stem cells (NSCs) with gene mutation, however, there is no enough evidence by now. This paper aims to get evidence of this area. Methods Glioma stem/progenitor cells (GSPCs) and neural stem/progenitor cells (NSPCs) were cultivated in vitro, and were identified before the following studies. Total RNA was isolated and then reverse⁃transcribed into cDNA, with primers specific to phosphatase and tensin homolog deleted onchromosome ten (PTEN), high⁃fidelity Taq polymerase was used for the polymerase chain reaction (PCR) to avoid the incorporation of pseudomutation. After amplification, 10 μl of the reaction mixture was electrophoresed through 1.5% agarose gel, and the rest of the reaction mixture was used for sequencing in both directions. The procedures for the isolation of total RNA to PCR and sequencing were repeated twice, and the sequencing results of both DNA and PTEN peptide chain were analysed with DNAssist 1.0 software and compared to the sequence of wild⁃type Homo Sapiens PTEN in GenBank. Results No mutation happened in the PTEN of NSPCs, but there were many base mutations in the mRNA of PTEN of GSPCs compared with the wild⁃type Homo Sapiens PTEN. Though most of these mutations were same sense mutation, still several mutations were not, including the normal DNA bases of PTEN bases 22 to 42 "ATCGTTAGCAGAAACAAAAGG" in first exon mutated into "CTACGATTGATTTGCATCTTT", base 712 "T" in exon 7 mutated into "C", and base 1192 "A" in exon 9 mutated into "T". Accordingly, for the amino acids (AA) sequence in the peptide chain of PTEN, the mutation included AA from the 8th to the 14th (from "IVSRNKR" to "LRLICIF"), the 238th AA (from "F" to "L"), and the 398th AA (from "T" to "S"). These mutated regions were involved in membrane interaction, particularly the combination with phosphatidylinositol 4, 5⁃biphosphate (PIP2) and maintaining the protein stability of PTEN. Therefore, these mutations not only lead to the rapid degradation of PTEN, but also hinder the cellular function of PTEN to down⁃regulate phosphoinostide 3⁃kinase (PI3K) signaling. Conclusion The mutation of PTEN occurs even in the early stage of malignant transformation, which is probably an initiating agent for the tumorigenesis of gliomas. DOI：10.3969/j.issn.1672-6731.2010.06.014

Adenovirus-mediated Wild-Type PTEN Promoting Glioma Stem/progenitor Cells Autophagy Activity

Autophagy impairment inhibits differentiation of glioma stem/progenitor cells.

Research of PTEN Mutation in Glioma Stem/progenitor Cells

Apoptotic Effects of the Exogenous PTEN Tumor Suppressor Gene on Human Mucoepidermoid Carcinoma Cell Line

Effects of Adenovirus Mediated PTEN on Angiogenesis and Growth of Glioma Cell U87

The Effects of Wild-Type PTEN Transfection on Gene Expressions of Glioblastomas

Experiment of adenovirus-mediated PTEN gene therapy for malignant glioma

Pten Negatively Regulates Neural Stem Cell Self-Renewal By Modulating G(0)-G(1) Cell Cycle Entry

[Expression of PTEN Gene in Human Glioma Cell Lines U251 and SHG-44 and Its Effect on Cell Proliferation].

PTEN deficiency reprogrammes human neural stem cells towards a glioblastoma stem cell-like phenotype

Effects of Wild-Type PTEN Transfection on the Invasion Ability of Glioma Cells

ARL4C Stabilized by AKT/mTOR Pathway Promotes the Invasion of PTEN‐deficient Primary Human Glioblastoma

Effects of Cotransfection of Antisense‐egfr and Wild‐type PTEN Cdna on Human Glioblastoma Cells

PTEN Status is Related to Cell Proliferation and Self-Renewal Independent of CD133 Phenotype in the Glioma-Initiating Cells

PTEN regulates expression of its pseudogene in glioblastoma cells in DNA methylation-dependent manner

Effects of PTEN over-expression and its mutant on the apoptosis of activated hepatic steilate cells in vitro

Phosphatase and Tensin Homolog Reconstruction and Vascular Endothelial Growth Factor Knockdown Synergistically Inhibit the Growth of Glioblastoma

Pten Restoration and Pik3cb Knockdown Synergistically Suppress Glioblastoma Growth in Vitro and in Xenografts

PTEN Gene Induces Apoptosis and Down-regulation of Bcl-2 Protein in Human Brain Glioma SHG-44 Cells

Reactivating PTEN to impair glioma stem cells by inhibiting cytosolic iron-sulfur assembly

Combined PTEN Mutation and Protein Expression Associate with Overall and Disease-Free Survival of Glioblastoma Patients