Abstract:Objective More and more attention has been given to the presumption that glioma stem cells (GSCs) originate from neural stem cells (NSCs) with gene mutation, however, there is no enough evidence by now. This paper aims to get evidence of this area. Methods Glioma stem/progenitor cells (GSPCs) and neural stem/progenitor cells (NSPCs) were cultivated in vitro, and were identified before the following studies. Total RNA was isolated and then reverse⁃transcribed into cDNA, with primers specific to phosphatase and tensin homolog deleted onchromosome ten (PTEN), high⁃fidelity Taq polymerase was used for the polymerase chain reaction (PCR) to avoid the incorporation of pseudomutation. After amplification, 10 μl of the reaction mixture was electrophoresed through 1.5% agarose gel, and the rest of the reaction mixture was used for sequencing in both directions. The procedures for the isolation of total RNA to PCR and sequencing were repeated twice, and the sequencing results of both DNA and PTEN peptide chain were analysed with DNAssist 1.0 software and compared to the sequence of wild⁃type Homo Sapiens PTEN in GenBank. Results No mutation happened in the PTEN of NSPCs, but there were many base mutations in the mRNA of PTEN of GSPCs compared with the wild⁃type Homo Sapiens PTEN. Though most of these mutations were same sense mutation, still several mutations were not, including the normal DNA bases of PTEN bases 22 to 42 "ATCGTTAGCAGAAACAAAAGG" in first exon mutated into "CTACGATTGATTTGCATCTTT", base 712 "T" in exon 7 mutated into "C", and base 1192 "A" in exon 9 mutated into "T". Accordingly, for the amino acids (AA) sequence in the peptide chain of PTEN, the mutation included AA from the 8th to the 14th (from "IVSRNKR" to "LRLICIF"), the 238th AA (from "F" to "L"), and the 398th AA (from "T" to "S"). These mutated regions were involved in membrane interaction, particularly the combination with phosphatidylinositol 4, 5⁃biphosphate (PIP2) and maintaining the protein stability of PTEN. Therefore, these mutations not only lead to the rapid degradation of PTEN, but also hinder the cellular function of PTEN to down⁃regulate phosphoinostide 3⁃kinase (PI3K) signaling. Conclusion The mutation of PTEN occurs even in the early stage of malignant transformation, which is probably an initiating agent for the tumorigenesis of gliomas. DOI：10.3969/j.issn.1672-6731.2010.06.014

PTEN regulates expression of its pseudogene in glioblastoma cells in DNA methylation-dependent manner

PTEN Methylation by NSD2 Controls Cellular Sensitivity to DNA Damage

PTEN Suppresses Glycolysis by Dephosphorylating and Inhibiting Autophosphorylated PGK1.

PTEN deficiency reprogrammes human neural stem cells towards a glioblastoma stem cell-like phenotype

Combined PTEN Mutation and Protein Expression Associate with Overall and Disease-Free Survival of Glioblastoma Patients

Mutational Analysis of the PTEN Gene in Gliomas: Molecular and Pathological Correlations

PRMT5-PTEN molecular pathway regulates senescence and self-renewal of primary glioblastoma neurosphere cells

Haploinsufficiency of phosphodiesterase 10A activates PI3K/AKT signaling independent of PTEN to induce an aggressive glioma phenotype

Pten Negatively Regulates Neural Stem Cell Self-Renewal By Modulating G(0)-G(1) Cell Cycle Entry

Research of PTEN Mutation in Glioma Stem/progenitor Cells

The Absence of PTEN in Breast Cancer Is a Driver of MLN4924 Resistance

PTEN loss in glioma cell lines leads to increased extracellular vesicles biogenesis and PD-L1 cargo in a PI3K-dependent manner

The PTEN-associated Immune Prognostic Signature Reveals the Landscape of the Tumor Microenvironment in Glioblastoma.

Identification of the Prognostic Signatures of Glioma With Different PTEN Status

Role of Ubiquitination in PTEN Cellular Homeostasis and Its Implications in GB Drug Resistance

Abstract 4449: TET1 Inhibits Gastric Cancer Metastasis by Demethylation and Re-Expression of PTEN

Interrogating Glioma-M2 Macrophage Interactions Identifies Gal-9/Tim-3 As a Viable Target Against PTEN-null Glioblastoma.

Ptenp1, A Natural Sponge of Mir-21, Mediates Pten Expression to Inhibit the Proliferation of Oral Squamous Cell Carcinoma

Pten Restoration and Pik3cb Knockdown Synergistically Suppress Glioblastoma Growth in Vitro and in Xenografts

The regulation of PTEN: Novel insights into functions as cancer biomarkers and therapeutic targets

[Expression of PTEN Gene in Human Glioma Cell Lines U251 and SHG-44 and Its Effect on Cell Proliferation].