Abstract:The deduced amino acid sequences characteristics, phylogeny, and functional diverge of ω-6 and ω-3 fatty acid desaturase families were analyzed by using Bioinformatics methods. The results showed that all the deduced amino acid sequences shared three highly conserved histidine rich motifs (Hisbox). All the plastidial ω-6 and ω-3 fatty acid desaturases possessed putative N-terminal signal peptide with different amino acids. A relatively conserved hydrophobic region composed of 10 amino-acid residues was found in the middle of signal peptides, which is presumed to be the functional region of the signal peptide of these enzymes. Most of the plant microsomal ω-6 and ω-3 fatty acid desaturases (FAD2 and FAD3) contained a KKXX-like motif of endoplasmic reticulum (ER) retention signal at the C-terminus. However, no such motif was detected in safflower CtFAD2-3, CtFAD2-4, CtFAD2-5, CtFAD2-6, and CtFAD2-7, while an aromatic aa enriched signal (YKNK) was found at their C-terminus which has been reported to be both necessary and sufficient for maintaining localization of the enzymes in the ER. All the amino acid sequences were divided into four categories through phylogenetic analysis. It was suggested that ω-3 fatty acid desaturase originates in a prokaryotic lineage from ω-6 fatty acid desaturase. Both plastidial and microsomal ω-3 fatty acid desaturases could be divided into dicotyledonous and monocotyledonous subgroups, which inferred that functional differentiation of plastidial and microsomal ω-3 fatty acid desaturases had been formed before the divergence of dicotyledonous and monocotyledonous plants. Seed type and housekeeping type FAD2 diverged after the formation of dicotyledonous plants. Except for plant FAD3/plant FAD2, posterior probability values over 0.80 amino acid sites were identified among the functional differentiation subsets, which were mainly distributed at the front and back end of Hisbox I, and the front end of Hisbox II. This indicated that the variations of these amino acid sites played an important role in the size and conformation of protein functional domains and subfamily functional divergence.

A Phylogenetic Analysis of the Membrane-bound Fatty Acid Desaturases

A Phylogenetic Analysis of △6-Fatty Acid Desaturases

Phylogeny and functional divergence of ω-6 and ω-3 fatty acid desaturase families]

Progress of Research on △12 Fatty Acid Desaturases and Their Coding Genes

Genome-Wide Analysis of Fatty Acid Desaturases in Soybean ( Glycine max )

Genome-Wide Analysis of Fatty Acid Desaturases in Soybean ()

Consensus mutagenesis and computational simulation provide insight into the desaturation catalytic mechanism for delta 6 fatty acid desaturase

Identification And Functional Expression Of A Delta 9 Fatty Acid Desaturase From The Marine Bacterium Pseudoalteromonas Sp Mly15

[Progress on Molecular Biology of Delta6-Fatty Acid Desaturases].

Characterization of 19 Genes Encoding Membrane-Bound Fatty Acid Desaturases and their Expression Profiles in Gossypium raimondii Under Low Temperature.

Cloning and bioinformatics analysis of omega-6 fatty acid desaturase genes in safflower(Carthamus tinctorius L.)

Isolation and Structural Analysis of Safflower ω3 Fatty Acid Desaturase

Structure and Function of Δ9-Fatty Acid Desaturase

Evolution-related amino acids play important role in determining regioselectivity of fatty acid desaturase from Pichia pastoris

Purification and Function Analysis of the Δ-17 Fatty Acid Desaturase with or Without Transmembrane Domain

Identification and characterization of a novel Delta6-fatty acid desaturase gene from Rhizopus arrhizus.

Δ6-Desaturase from Mortierella Alpina: Cdna Cloning, Expression, and Phylogenetic Analysis.

Genome-Wide Identification Of Membrane-Bound Fatty Acid Desaturase Genes In Gossypium Hirsutum And Their Expressions During Abiotic Stress

Cloning and Sequence Analysis of Δ12 Fatty Acid Desaturase of Chlorella Vulgaris

Gctgtcaaca cccatggctg agagctc nthg nthr gagctctcagccatgggtgttgacagc hthl gctgtccaca cccatggctg agagctc hthg hthr gagctctcagccatgggtgtggacagc nahl gctgtcaacg cccatggctg agagctc nahg nahr gagctctcagccatgggcgttgacagc nshr gctgtcaact cccatggctg agagctc nshg nshl gagctctcagccatgggagttgacagc athl gctgtcgc

Substrate specificity, regioselectivity and cryptoregiochemistry of plant and animal omega-3 fatty acid desaturases