Abstract:Objective More and more attention has been given to the presumption that glioma stem cells (GSCs) originate from neural stem cells (NSCs) with gene mutation, however, there is no enough evidence by now. This paper aims to get evidence of this area. Methods Glioma stem/progenitor cells (GSPCs) and neural stem/progenitor cells (NSPCs) were cultivated in vitro, and were identified before the following studies. Total RNA was isolated and then reverse⁃transcribed into cDNA, with primers specific to phosphatase and tensin homolog deleted onchromosome ten (PTEN), high⁃fidelity Taq polymerase was used for the polymerase chain reaction (PCR) to avoid the incorporation of pseudomutation. After amplification, 10 μl of the reaction mixture was electrophoresed through 1.5% agarose gel, and the rest of the reaction mixture was used for sequencing in both directions. The procedures for the isolation of total RNA to PCR and sequencing were repeated twice, and the sequencing results of both DNA and PTEN peptide chain were analysed with DNAssist 1.0 software and compared to the sequence of wild⁃type Homo Sapiens PTEN in GenBank. Results No mutation happened in the PTEN of NSPCs, but there were many base mutations in the mRNA of PTEN of GSPCs compared with the wild⁃type Homo Sapiens PTEN. Though most of these mutations were same sense mutation, still several mutations were not, including the normal DNA bases of PTEN bases 22 to 42 "ATCGTTAGCAGAAACAAAAGG" in first exon mutated into "CTACGATTGATTTGCATCTTT", base 712 "T" in exon 7 mutated into "C", and base 1192 "A" in exon 9 mutated into "T". Accordingly, for the amino acids (AA) sequence in the peptide chain of PTEN, the mutation included AA from the 8th to the 14th (from "IVSRNKR" to "LRLICIF"), the 238th AA (from "F" to "L"), and the 398th AA (from "T" to "S"). These mutated regions were involved in membrane interaction, particularly the combination with phosphatidylinositol 4, 5⁃biphosphate (PIP2) and maintaining the protein stability of PTEN. Therefore, these mutations not only lead to the rapid degradation of PTEN, but also hinder the cellular function of PTEN to down⁃regulate phosphoinostide 3⁃kinase (PI3K) signaling. Conclusion The mutation of PTEN occurs even in the early stage of malignant transformation, which is probably an initiating agent for the tumorigenesis of gliomas. DOI：10.3969/j.issn.1672-6731.2010.06.014

PTEN Status is Related to Cell Proliferation and Self-Renewal Independent of CD133 Phenotype in the Glioma-Initiating Cells

Activation of PI3K/Akt pathway by CD133-p85 interaction promotes tumorigenic capacity of glioma stem cells

Research of PTEN Mutation in Glioma Stem/progenitor Cells

[Expression of PTEN Gene in Human Glioma Cell Lines U251 and SHG-44 and Its Effect on Cell Proliferation].

Pten Negatively Regulates Neural Stem Cell Self-Renewal By Modulating G(0)-G(1) Cell Cycle Entry

Pten Restoration and Pik3cb Knockdown Synergistically Suppress Glioblastoma Growth in Vitro and in Xenografts

PTEN loss in glioma cell lines leads to increased extracellular vesicles biogenesis and PD-L1 cargo in a PI3K-dependent manner

RETRACTED ARTICLE: Relationships Between PTEN Gene Mutations and Prognosis in Glioma: a Meta-Analysis

PTEN regulates expression of its pseudogene in glioblastoma cells in DNA methylation-dependent manner

Identification of the Prognostic Signatures of Glioma With Different PTEN Status

PTEN deficiency reprogrammes human neural stem cells towards a glioblastoma stem cell-like phenotype

Combined PTEN Mutation and Protein Expression Associate with Overall and Disease-Free Survival of Glioblastoma Patients

Biological Implication of PTEN Gene Expression in Human Gastric Cancer and Related Molecular Mechanisms

Expression of P57kip2, PTEN Protein in Human Gliomas and Its Significance

Significance of PCNA and PTEN expressions in glioma tissue

Genetic alterations and expression of PTEN and its relationship with cancer stem cell markers to investigate pathogenesis and to evaluate prognosis in hepatocellular carcinoma.

Faculty Opinions Recommendation of A Hierarchy of Self-Renewing Tumor-Initiating Cell Types in Glioblastoma.

Protein Phosphatase Activity Of Pten Inhibited The Invasion Of Glioma Cells With Epidermal Growth Factor Receptor Mutation Type Iii Expression

CD133 in Identifying Perivascular Niche of Glioma Stem Cells

Expression of PTEN in Human Glioma and its Relationship with FAKpY397 and MVD

PTEN inhibits proliferation of cervical cancer cells by AKT mediated cell metabolism