Abstract:Toll-like receptor-mediated NF-κB pathways are essential for inducing immune related-gene expression in the defense against bacterial, fungal and viral infections in insects and mammals. Although a Toll receptor (LvToll1) was cloned in Litopenaeus vannamei, relatively little is known about other types of Toll-like receptors and their endogenous cytokine-like ligand, Spätzle. Here, we report two novel Toll-like receptors (LvToll2 and LvToll3) and three Spätzle-like proteins (LvSpz1-3) from L. vannamei. LvToll2 has 1009 residues with an extracellular domain containing 18 leucine-rich repeats (LRRs) and a cytoplasmic Toll/interleukin-1 receptor (TIR) domain of 139 residues. LvToll3 is 1244 residues long with an extracellular domain containing 23 LRRs and a cytoplasmic TIR domain of 138 residues. The Spätzle-like proteins LvSpz1, LvSpz2 and LvSpz3 are 237, 245 and 275 residues in length, respectively, and all of them have a putative C-terminal cystine-knot domain. In Drosophila Schneider 2 (S2) cells, LvToll1 and LvToll3 were localized to the membrane and cytoplasm, and LvToll2 was confined to the cytoplasm. In Drosophila S2 cells, LvToll2 could significantly activate the promoters of NF-κB-pathway-controlled antimicrobial peptide genes, whereas LvToll1 and LvToll3 had no effect on them. LvSpz1 exerted some degree of inhibition on the promoter activities of Drosophila Attacin A and L. vannamei Penaeidin4. LvSpz3 also inhibited the Drosophila Attacin A promoter, but LvSpz2 could only slightly activate it. LvToll1, LvToll2 and LvToll3 were constitutive expressed in various tissues, while LvSpz1, LvSpz2 and LvSpz3 exhibited tissue-specific expression in the epithelium, eyestalk, intestine, gill and muscle. In the gill, after Vibrio alginolyticus challenge, LvToll1 was upregulated, but LvToll2 and LvToll3 showed no obvious changes. LvSpz1 and LvSpz3 were also strongly induced by V. alginolyticus challenge, but LvSpz2 only showed a slight downregulation. In the gill, after white spot syndrome virus (WSSV) challenge, LvToll1, LvToll2, LvToll3, LvSpz1 and LvSpz3 were upregulated, but LvSpz2 showed no obvious change, except for a slight downregulation at 12h post-injection of WSSV. These findings might be valuable in understanding the innate immune signal pathways of shrimp and enabling future studies on the host-pathogen interactions in V. alginolyticus and WSSV infections.

Litopenaeus Vannamei Tumor Necrosis Factor Receptor-Associated Factor 6 (traf6) Responds to Vibrio Alginolyticus and White Spot Syndrome Virus (wssv) Infection and Activates Antimicrobial Peptide Genes

Molecular characterization and functional analysis of TRAF6 in the spotted sea bass (Lateolabrax maculatus)

TNF-Receptor-Associated Factor 3 in Litopenaeus Vannamei Restricts White Spot Syndrome Virus Infection Through the IRF-Vago Antiviral Pathway

Molecular Cloning, Characterization And Expression Analysis Of The Tumor Necrosis Factor (Tnf) Superfamily Gene, Tnf Receptor Superfamily Gene And Lipopolysaccharide-Induced Tnf-Alpha Factor (Litaf) Gene From Litopenaeus Vannamei

Molecular Characterization and Functional Analysis of TRAF6 in Orange-Spotted Grouper (epinephelus Coioides).

Involvement of tumor necrosis factor receptor-associated factor 6 (TRAF6) in NF-κB activation and antiviral immunity: Molecular and functional characterization of TRAF6 in red-spotted grouper (Epinephelus akaara)

Tgaagatggtcgaggggtaagccg ggcatcagacccatcacccagaa tacc ttgaagccgaaacacagagcca atct tactgtgttcattgtgtcattgg acgagtccgagttcat aggttgacgaggaaca ttgcgccgtactcat ggtctgtccgttctt acggaattccctcct tgcaacgcatagacc actctccttacgatg cagacaggtctccaa ccacctgactgtacc tactgacgaggcaat ctggaggaggaaact agacacttggactcg

An Activating Transcription Factor of Litopenaeus Vannamei Involved in WSSV Genes Wsv059 and Wsv166 Regulation.

Activating Transcription Factor 4 and X Box Binding Protein 1 of Litopenaeus Vannamei Transcriptional Regulated White Spot Syndrome Virus Genes Wsv023 and Wsv083

Litopenaeus Vannamei Activating Transcription Factor 6 Alpha Gene Involvement in ER-stress Response and White Spot Symptom Virus Infection.

Teleost TRAF7, a protein functions in the host antiviral responses via NF-κB and IRF3/7 mediated signaling

Cloning, Promoter Analysis and Expression of the Tumor Necrosis Factor Receptor-Associated Factor 6 (TRAF6) in Japanese Scallop (mizuhopecten Yessoensis)

Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spätzle-like Toll ligands (LvSpz1-3) from Litopenaeus vannamei.

Novel Findings in Teleost TRAF4, a Protein Acts as an Enhancer in TRIF and TRAF6 Mediated Antiviral and Inflammatory Signaling

Genome-wide Identification and Characterization of TRAF Genes in the Yesso Scallop (patinopecten Yessoensis) and Their Distinct Expression Patterns in Response to Bacterial Challenge.

Litopenaeus Vannamei Sterile-Alpha And Armadillo Motif Containing Protein (Lvsarm) Is Involved In Regulation Of Penaeidins And Antilipopolysaccharide Factors

Molecular Cloning, Characterization and Function of a Germinal Center Kinase MST4 Gene from Litopenaeus Vannamei in Response to Vibrio Alginolyticus Challenge in TLR-TRAF6 Signaling Pathway.

Identification of the Thioredoxin-Related Protein of 14 Kda (TRP14) from Litopenaeus Vannamei and Its Role in Immunity

Identification and Characterization of a Mitochondrial Unfolded Protein Response Transcription Factor ATFS-1 in Litopenaeus Vannamei.

Members of the TRAF gene family in Octopus sinensis and their response to PGN, poly I:C, and Vibrio parahaemolyticus

MKK6 from Pacific White Shrimp Litopenaeus Vannamei is Responsive to Bacterial and WSSV Infection.