Abstract:Toll-like receptor-mediated NF-κB pathways are essential for inducing immune related-gene expression in the defense against bacterial, fungal and viral infections in insects and mammals. Although a Toll receptor (LvToll1) was cloned in Litopenaeus vannamei, relatively little is known about other types of Toll-like receptors and their endogenous cytokine-like ligand, Spätzle. Here, we report two novel Toll-like receptors (LvToll2 and LvToll3) and three Spätzle-like proteins (LvSpz1-3) from L. vannamei. LvToll2 has 1009 residues with an extracellular domain containing 18 leucine-rich repeats (LRRs) and a cytoplasmic Toll/interleukin-1 receptor (TIR) domain of 139 residues. LvToll3 is 1244 residues long with an extracellular domain containing 23 LRRs and a cytoplasmic TIR domain of 138 residues. The Spätzle-like proteins LvSpz1, LvSpz2 and LvSpz3 are 237, 245 and 275 residues in length, respectively, and all of them have a putative C-terminal cystine-knot domain. In Drosophila Schneider 2 (S2) cells, LvToll1 and LvToll3 were localized to the membrane and cytoplasm, and LvToll2 was confined to the cytoplasm. In Drosophila S2 cells, LvToll2 could significantly activate the promoters of NF-κB-pathway-controlled antimicrobial peptide genes, whereas LvToll1 and LvToll3 had no effect on them. LvSpz1 exerted some degree of inhibition on the promoter activities of Drosophila Attacin A and L. vannamei Penaeidin4. LvSpz3 also inhibited the Drosophila Attacin A promoter, but LvSpz2 could only slightly activate it. LvToll1, LvToll2 and LvToll3 were constitutive expressed in various tissues, while LvSpz1, LvSpz2 and LvSpz3 exhibited tissue-specific expression in the epithelium, eyestalk, intestine, gill and muscle. In the gill, after Vibrio alginolyticus challenge, LvToll1 was upregulated, but LvToll2 and LvToll3 showed no obvious changes. LvSpz1 and LvSpz3 were also strongly induced by V. alginolyticus challenge, but LvSpz2 only showed a slight downregulation. In the gill, after white spot syndrome virus (WSSV) challenge, LvToll1, LvToll2, LvToll3, LvSpz1 and LvSpz3 were upregulated, but LvSpz2 showed no obvious change, except for a slight downregulation at 12h post-injection of WSSV. These findings might be valuable in understanding the innate immune signal pathways of shrimp and enabling future studies on the host-pathogen interactions in V. alginolyticus and WSSV infections.

Litopenaeus Vannamei Sterile-Alpha And Armadillo Motif Containing Protein (Lvsarm) Is Involved In Regulation Of Penaeidins And Antilipopolysaccharide Factors

Identification and function of an Arasin-like peptide from Litopenaeus vannamei

Sarm: A Novel Toll-Like Receptor Adaptor, is Functionally Conserved from Arthropod to Human

An anti-lipopolysaccharide factor in Litopenaeus vannameiparticipates in the immune defense against WSSV and Vibrio anguillarum

Identification And Function Of Leucine-Rich Repeat Flightless-I-Interacting Protein 2 (Lrrfip2) In Litopenaeus Vannamei

Analysis of Expression, Cellular Localization, and Function of Three Inhibitors of Apoptosis (iaps) from Litopenaeus Vannamei During WSSV Infection and in Regulation of Antimicrobial Peptide Genes (Amps)

Functional Characterization of A Deformed Epidermal Autoregulatory Factor 1 Gene in Litopenaeus vannamei

A Lymphoid Organ Specific Anti-Lipopolysaccharide Factor from Litopenaeus vannamei Exhibits Strong Antimicrobial Activities

Litopenaeus Vannamei Toll-Interacting Protein (lvtollip) is A Potential Negative Regulator of the Shrimp Toll Pathway Involved in the Regulation of the Shrimp Antimicrobial Peptide Gene Penaeidin-4 (Pen4)

Molecular Cloning, Characterization And Expression Analysis Of The Tumor Necrosis Factor (Tnf) Superfamily Gene, Tnf Receptor Superfamily Gene And Lipopolysaccharide-Induced Tnf-Alpha Factor (Litaf) Gene From Litopenaeus Vannamei

LvCD14L Acts as a Novel Pattern Recognition Receptor and a Regulator of the Toll Signaling Pathway in Shrimp

The ARM repeat domain of hemocyanin interacts with MKK4 to modulate antimicrobial peptides expression

An immune deficiency homolog from the white shrimp, Litopenaeus vannamei, activates antimicrobial peptide genes

Comparative Study of Five Anti-Lipopolysaccharide Factor Genes in Litopenaeus Vannamei.

A Low-Density Lipoprotein Receptor (LDLR) Class A Domain-Containing C-type Lectin from Litopenaeus Vannamei Plays Opposite Roles in Antibacterial and Antiviral Responses.

Molecular Characterization of an LRR-only Protein Gene in Pacific White Shrimp Litopenaeus Vannamei: Sequence Feature, Expression Pattern, and Protein Activity.

Tgaagatggtcgaggggtaagccg ggcatcagacccatcacccagaa tacc ttgaagccgaaacacagagcca atct tactgtgttcattgtgtcattgg acgagtccgagttcat aggttgacgaggaaca ttgcgccgtactcat ggtctgtccgttctt acggaattccctcct tgcaacgcatagacc actctccttacgatg cagacaggtctccaa ccacctgactgtacc tactgacgaggcaat ctggaggaggaaact agacacttggactcg

The immune function of a NLR like gene, LvNLRPL1, in the Pacific whiteleg shrimp Litopenaeus vannamei

Molecular Characterization and Function of a P38 MAPK Gene from Litopenaeus Vannamei

Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spätzle-like Toll ligands (LvSpz1-3) from Litopenaeus vannamei.

Identification, Characterization and Functional Analysis of A Serine Protease Inhibitor (lvserpin) from the Pacific White Shrimp, Litopenaeus Vannamei