Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Corrigendum: Long-term exposure to BAY2416964 reduces proliferation, migration and recapitulates transcriptional changes induced by AHR loss in PyMT-induced mammary tumor cells

Long-term exposure to BAY2416964 reduces proliferation, migration and recapitulates transcriptional changes induced by AHR loss in PyMT-induced mammary tumor cells

Publisher Correction: PP2A inhibition from LB100 therapy enhances daunorubicin cytotoxicity in secondary acute myeloid leukemia via miR-181b-1 upregulation

Erratum: Artemin is estrogen regulated and mediates antiestrogen resistance in mammary carcinoma

Correction: Corrigendum: Reduced cell proliferation by IKK2 depletion in a mouse lung-cancer model

[Corrigendum] Azurocidin 1 inhibits the aberrant proliferation of triple‐negative breast cancer through the regulation of pyroptosis

[Corrigendum] A Regulation Loop Between Nrf1α and MRTF‑A Controls Migration and Invasion in MDA‑MB‑231 Breast Cancer Cells.

[Corrigendum] Antiproliferative effect of alpinetin in BxPC-3 pancreatic cancer cells

[Corrigendum] HepaCAM inhibits cell proliferation and invasion in prostate cancer by suppressing nuclear translocation of the androgen receptor via its cytoplasmic domain

Corrigendum: Effectiveness and Safety of Pyrotinib, and Association of Biomarker With Progression-Free Survival in Patients With HER2-Positive Metastatic Breast Cancer: A Real-World, Multicentre Analysis

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

Corrigendum: Downregulation of GLYAT Facilitates Tumor Growth and Metastasis and Poor Clinical Outcomes Through the PI3K/AKT/Snail Pathway in Human Breast Cancer

[Corrigendum] Anti‐osteoporotic effects of tetramethylpyrazine via promoting osteogenic differentiation and inhibiting osteoclast formation

Corrigendum: Identification of DYNLT1 associated with proliferation, relapse, and metastasis in breast cancer

[Corrigendum] SB‑T‑121205, a Next‑generation Taxane, Enhances Apoptosis and Inhibits Migration/invasion in MCF‑7/PTX Cells.

[Corrigendum] Tripartite motif‐containing 11 regulates the proliferation and apoptosis of breast cancer cells

[Corrigendum] BMP‐6 inhibits the metastasis of MDA‐MB‐231 breast cancer cells by regulating MMP‐1 expression

[Corrigendum] Role of 4‑aminobutyrate Aminotransferase (ABAT) and the Lncrna Co‑expression Network in the Development of Myelodysplastic Syndrome

Correction to: Therapeutic efficacy of the novel SHP2 degrader SHP2-D26, alone or in combination, against lung cancer is associated with modulation of p70S6K/S6, Bim and Mcl-1

[Corrigendum] Nucleosome‐binding protein HMGN2 exhibits antitumor activity in human SaO2 and U2‐OS osteosarcoma cell lines

Corrigendum to “Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells”