Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

Correction: Qian et al. Capsaicin Suppresses Cell Proliferation, Induces Cell Cycle Arrest and ROS Production in Bladder Cancer Cells through FOXO3a-Mediated Pathways. Molecules 2016, 21, 1406

Correction to: Cryptotanshinone activates AMPK-TSC2 axis leading to inhibition of mTORC1 signaling in cancer cells

Erratum to “Berbamine Suppresses the Progression of Bladder Cancer by Modulating the ROS/NF-κB Axis”

[Corrigendum] Celecoxib inhibits the epithelial‐to‐mesenchymal transition in bladder cancer via the miRNA‐145/TGFBR2/Smad3 axis

[Corrigendum] Sulforaphane suppresses the viability and metastasis, and promotes the apoptosis of bladder cancer cells by inhibiting the expression of FAT‐1

Correction To: Methylseleninic Acid Suppresses Breast Cancer Growth Via the JAK2/STAT3 Pathway

Correction: Huang et al. Endogenous Propionibacterium acnes Promotes Ovarian Cancer Progression via Regulating Hedgehog Signalling Pathway. Cancers 2022, 14, 5178

[Retracted] Sulforaphane regulates apoptosis‐ and proliferation‐related signaling pathways and synergizes with cisplatin to suppress human ovarian cancer

Correction: Shi, H., et al. Arctigenin Attenuates Breast Cancer Progression through Decreasing GM-CSF/TSLP/STAT3/β-Catenin Signaling. Int. J. Mol. Sci. 2020, 21, 6357

Corrigendum to “yangjing Capsule Extract Promotes Proliferation of GC-1 Spg Cells”

Erratum: Lycorine hydrochloride inhibits melanoma cell proliferation, migration and invasion via down-regulating p21Cip1/WAF1

Corrigendum: Downregulation of HMGA1 Mediates Autophagy and Inhibits Migration and Invasion in Bladder Cancer via miRNA-221/TP53INP1/p-ERK Axis

KLF5 downregulation desensitizes castration-resistant prostate cancer cells to docetaxel by increasing BECN1 expression and inducing cell autophagy: Erratum

Correction: Cui, H., et al. BA-12 Inhibits Angiogenesis via Glutathione Metabolism Activation. Int. J. Mol. Sci. 2019, 20, 4062

Corrigendum to "Yangjing Capsule Extract Promotes Proliferation of GC-1 Spg Cells".

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

[Corrigendum] The cranberry flavonoids PAC DP‑9 and quercetin aglycone induce cytotoxicity and cell cycle arrest and increase cisplatin sensitivity in ovarian cancer cells

[Corrigendum] P2Y2 receptor promotes the migration and invasion of breast cancer cells via EMT‑related genes Snail and E‑cadherin

[Corrigendum] HepaCAM inhibits cell proliferation and invasion in prostate cancer by suppressing nuclear translocation of the androgen receptor via its cytoplasmic domain

Correction: YAP Suppresses Lung Squamous Cell Carcinoma Progression Via Deregulation of the DNp63–GPX2 Axis and ROS Accumulation

Correction to: Inhibiting reactive oxygen species-dependent autophagy enhanced baicalein-induced apoptosis in oral squamous cell carcinoma