Abstract:Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re‑examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF‑7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'‑AGACCATGTGGACCTGTCACTG‑3', and reverse, 5'‑GTTTGGAGTGGTAGAAATCTGTC‑3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'‑GAGGCAAAAGTCCTGTGTTCCAACT‑3', and reverse, 5'‑AAGAAATCCCTGTGGTTGCAGCAGCT‑3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti‑GAPDH antibodies was incorrectly stated as AbMart Bio‑tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033‑1042, 2019; DOI: 10.3892/ijo.2019.4679].

[Corrigendum] Long non‐coding RNA HR1 participates in the expression of SREBP‐1c through phosphorylation of the PDK1/AKT/FoxO1 pathway

[Corrigendum] Long non‑coding RNA LINC00238 suppresses the malignant phenotype of liver cancer by sponging miR‑522.

Corrigendum: Long-range RNA Pairings Contribute to Mutually Exclusive Splicing

[Corrigendum] Long Non‑coding RNA H19 Regulates LASP1 Expression in Osteosarcoma by Competitively Binding to Mir‑29a‑3p.

Corrigendum for “lncrna EPB41L4A-AS1 Regulates Glycolysis and Glutaminolysis by Mediating Nucleolar Translocation of HDAC2” [ebiomedicine 41 (2019) 200–213]

Correction: Corrigendum: The RSPO–LGR4/5–ZNRF3/RNF43 module controls liver zonation and size

[Corrigendum] Exosomal microRNA‑4516, microRNA‑203 and SFRP1 are potential biomarkers of acute myocardial infarction

[Corrigendum] A Regulation Loop Between Nrf1α and MRTF‑A Controls Migration and Invasion in MDA‑MB‑231 Breast Cancer Cells.

[Corrigendum] Long Non‑coding RNA AC245100.4 Promotes Prostate Cancer Tumorigenesis Via the Microrna‑145‑5p/rbbp5 Axis.

[Corrigendum] PRIMA‐1 met induces autophagy in colorectal cancer cells through upregulation of the mTOR/AMPK‐ULK1‐Vps34 signaling cascade

Correction: Wang et al. Integration of Transcriptomics and Lipidomics Profiling to Reveal the Therapeutic Mechanism Underlying Ramulus mori (Sangzhi) Alkaloids for the Treatment of Liver Lipid Metabolic Disturbance in High-Fat-Diet/Streptozotocin-Induced Diabetic Mice. Nutrients 2023, 15, 3914

[Corrigendum] Propofol‐induced HOXA11‐AS promotes proliferation, migration and invasion, but inhibits apoptosis in hepatocellular carcinoma cells by targeting miR‐4458

Corrigendum: Loss of TARBP2 Drives the Progression of Hepatocellular Carcinoma Via Mir-145-serpine1 Axis

[CORRIGENDUM] Long non‐coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway

[Corrigendum] Synergistic cardioprotective effects of Danshensu and hydroxysafflor yellow A against myocardial ischemia-reperfusion injury are mediated through the Akt/Nrf2/HO-1 pathway

[Corrigendum] Resveratrol reverses P‐glycoprotein‐mediated multidrug resistance of U2OS/ADR cells by suppressing the activation of the NF‐κB and p38 MAPK signaling pathways

Correction: Celastrol Suppresses Angiogenesis-Mediated Tumor Growth through Inhibition of AKT/Mammalian Target of Rapamycin Pathway

[Retracted] LncRNA TUG1 serves an important role in hypoxia‐induced myocardial cell injury by regulating the miR‐145‐5p‐Binp3 axis

[Corrigendum] MicroRNA‑92a Contributes to Tumor Growth of Human Hepatocellular Carcinoma by Targeting FBXW7

[Retracted] Hypoxia‐induced overexpression of DEC1 is regulated by HIF‐1α in hepatocellular carcinoma

[Corrigendum] Role of cysteine‐rich angiogenic inducer 61 in fibroblast‐like synovial cell proliferation and invasion in rheumatoid arthritis